Microarray Probes on PGSC0003DMT400001780

Probe IDChipProbe Sequence
CUST_34699_PI426222305 JHI_St_60k_v1 CCTTCTCACCCTTATGATAGATCCCAAGCCAGATTTTGGGCTGACTATATAGATAAAAAG

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001780

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001780 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G17180.1 +2 2e-68 204 95/158 (60%) glutathione S-transferase TAU 25 | chr1:5872208-5872958 FORWARD LENGTH=221

Transcript Sequence (947 bp)

>PGSC0003DMT400001780 947 pgsc_dm_v3.4
CTTAACTATTCATTTAAAAAATGGAAGGCACCAATAATGTGGTTCTACTGGATTTCTGGG
CAAGCTCATTTGGTATGAGGCTAAGAATTGCATTGGCATTAAAAGGGATCCAATATGAAG
GGAGAGAGGAAAATTTATTTGATAAAAGTCCTCTGCTTCTAAAGATGAACTCTGTTCATA
AAAAAATCCCTGTTGTGAGTCTCTTATCATTCTTGAGTACATTGATCAAGTTTGGCATGA
CAAATATCCCTTACTTCCTTCTCACCCTTATGATAGATCCCAAGCCAGATTTTGGGCTGA
CTATATAGATAAAAAGATATATAGCACAGGAAGAAGAGTTTGGAGTGGTAAAGGTGAAGA
TCAAGAGGAAGCAAAGAAGGACTTAATAGAAATTTTCAAGACATTGGAAGGAGAGCTTGG
AGACAAAACATACTTTGGTGGTGATGAGAATTTGGGTTTTGTGGATGTGGCTTTGGTTCC
TTTCTCTAGTTGGTTTTATTCTAATGAGACTTGTGCAAATTTCAGTATAGAAGCAGAGTG
TTCAATACTAGTGGCATGGGCTAAAAGATGCATGGAAATTGAGAGTGTCTCAAACTCCCT
TCCTCATCCTCACAAAATCTATGCTTATGTCTTGGAACTCAAGAACAAATTTGGTCTACC
CTAGCCTAGTTACTCACACCACTTTAATCGAGGAAGCTTAGTAGCTCGATTGGTTTGTTA
CGTGAACTTTTTCCTTGAATTAATGTAGTGTACGCCAGAGTGAATTTACTGTGTAATTTA
GATATTTTGTACTGTCACATAATTTCTTTGCATCAATAGTTGGTTGAGTTAAATAAATAA
AGTATAAGCTCTATATGTGATCAAGTTGATATTCTTAAGAGTTCTACAACTGAGGTTAAT
AGTTCCTTCATATATGTAAGTTTTGTTTATTGGAACTGAGAAATTTT