Microarray Probes on PGSC0003DMT400001587

Probe IDChipProbe Sequence
CUST_17468_PI426222305 JHI_St_60k_v1 GCTACAGAGCTGCCAATCCCTTTGATATTGACACTCTTTAAAATTGTAAATCAGTATCAT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400001587

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400001587 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT5G54180.1 +2 1e-155 466 247/413 (60%) plastid transcriptionally active 15 | chr5:21988544-21990183 FORWARD LENGTH=500

Transcript Sequence (2322 bp)

>PGSC0003DMT400001587 2322 pgsc_dm_v3.4
TTTTAACCCGTTACTAGTTGGAGAGTGACACTTTGGAGCAACAGCTTTAACTATCATCAT
CTACCTTATCGCCAAGCAACTGGCTGCAGTGTTGCCTCCTTTGTTACCATGTCGACGCCC
ACCAAATCTTTTCCTCTTTCGCCTTCTCCTTCCTGTTTATCTCGGGCTTTATCTCCCCCC
ATACGAACTCTCTTTCCTTCTGCGTTGCTCCCTTCTCAGAAACTCACATTTTCCCTACAG
AAACAAGATAAACTACCTTTACACTTTCTGGTTCCTCAAGATTCCACGCTTTTACTGCTC
AAATGCAACGCCCTCGCCATCAACAACAGCTCTACAAATTCTTTCGTCGATTCCGGTGAG
TTTCTTTCTCTCAGGTCAAATATCAAACACCTGATGTGTTTCTATCATCCCCATTTCTTT
GACTGCTCTTCAATGGTCTCTTTTCTCAGGGGTGATGCTATTTTCACTCTTTCGAGAAAT
TGGGTTCAATGAGACTGATACTGAAGCTCTTTTGGACGCCCACCCAGCAATTAACCTGAC
GCCATTCGAATCCATACGCACGCGAATTCATTCTTTGCAGTCCCTTGGGGTCAGCGGCCT
TGCTCTTTCAAGATTGATTGTGAAAAGACCAGATGTTTTAACAGCTGTGGAAATTGATGG
CCTTGTTAGTTTTCTTCTCAAGGGTGATTTGGAATTGGCTGGAAAAATCAAATCTTCACA
GATTGAACATCTTTTGAACTCAACAGAACCAAGGTTTCTTGCAGGATTTGAAACAAAGGT
TCGATTGTTACTCGAACTTGGGATTACCCAAGAAACGATTGTTCATGTTCTCAACAATGC
CAACTTAACAAAGGCATTTTGTCTCAAGTCATTTGAAGATATAGAAAGAATGCTTACTTT
CTTGAACCGTTTTGGTGGTGGTGATTTGATTCTTCGCCGACCAGCACTTCTCAATTATGA
CCTTGATGCCCAGTTGATTCCCAGGGTAGGGTTCCTCTTGGAGCTGAGTGGAGGTGATGA
GACTGGAACTGCAACCGTGTTGCGTAAGTTGCCATTTGTTGTAGCATATAGCGTTGATCA
CTTAAAAGATCATGTAGAATTCTTGAAATCATATGCTGGCTTAAGTGAGGAGGAGATTTT
TCGAATTGTTTTAGTTTATCCCAATATGTTTAGTGCCAGCAGGAAAAGGAAATTGCATCC
TCGAATTGATTTTCTAAAGCAATGTGGGTTGAGTTCACATGATATATTCAGGTTCTTAAT
AAAAGCTCCTTTATTTCTGAGTCTGTCATTTGAGGGGAATCTCGCTTACAAGCTGGTCTT
TTTGGTGAAGATTGGGTATAAGAAGAATACTAAGGAATTGGCTATGGCAATGGGAGCTGT
AACCAGGACTAGCTGCAAAAATATGCAAGAAGTTATTGGCGTATTTTTGAACTACGGCTT
GACTTTTGATGACATTCTGGAGATGAGCATGAAACATCCGCAGGTATTACAGTACAATCA
TGAGTCACTGGAGGAGAAGATGGACTACTTGGTTGAAGAGATGGGTCGTGAAGTTGGGGA
GCTATTGGCTTTTCCTGCATTTCTTGGGTACAAGCTTGACGGAAGGATTAAACACAGGTA
CGAAGAGAAAAGAAAGATCTTAGGGGAAGGCATGTCGCTCAATAAACTTCTGAGTGTGTC
TGCAGCAAGATTCTCAACAAAAAGCAAGAGGAAGCAACGAGTTCCTGCCGTTAGTGGCCT
CGATGAGAGTGATGAATGATTGAAATGATTTTTGAGACATTATATGTTGTTATAAGCGTG
TGAAAATCTCTATTGAATGTTAAACCCAAAGGTTTGATGGTTCTGTTAGATCAATTCGGT
TTTGCGGATTCCTGATTTTGTTCTTCTGCCCGAGTACAGGACATGCCTATGGACATATTT
GCAGAGGAATGGAAGAAATATGAACAACACCTTCTTTCATTGGCTGAGCATTGGATGTTG
AGGTATTGGTGTTCTTCATGGCTGAGTAAGGACATGATTTTAACTTTTAGTCTGTTTTTC
TAGAAAGGTTTGGTGAGCGTCTTTGCGTTATTCGTAAATAGGGCTTCTTATGAACTAGTG
ATCGTACATTAGTGCAAGTTCTCAATACATACAGCTGATAGTTGACAGCACATTGAAACT
GCTATTCCTGTTGACGATGTGCTACAGAGCTGCCAATCCCTTTGATATTGACACTCTTTA
AAATTGTAAATCAGTATCATATATTGCAAATTCTGATTTATCTTATGCCTATTTTTCCTT
TTAAAATATGGTGCATATGTGCTTTTCAAAGACAAATTATAC