Microarray Probes on PGSC0003DMT400000454

Probe IDChipProbe Sequence
CUST_3208_PI426222305 JHI_St_60k_v1 GCCTAGCTACAAGTTGGAGTATACCAGAACCTGAAGACTTACTTTTGAAATAAAATTTGT

Link to Spud DB Genome Browser for Transcript PGSC0003DMT400000454

Click here to view details at Spud DB Genome Browser (opens in new window)



Source Transcript PGSC0003DMT400000454 - Homology to Model Species (BLASTX to E-value < 1e-50)

DatabaseLink to BLAST HitFrameE-valueScore% IdentityDescription
Tomato (ITAG)None-----
TAIR PP10 AT1G01770.1 +2 3e-47 178 87/129 (67%) unknown protein; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF1446 (InterPro:IPR010839); Has 1597 Blast hits to 1509 proteins in 306 species: Archae - 4; Bacteria - 843; Metazoa - 22; Fungi - 131; Plants - 31; Viruses - 0; Other Eukaryotes - 566 (source: NCBI BLink). | chr1:278759-282490 FORWARD LENGTH=632

Transcript Sequence (2408 bp)

>PGSC0003DMT400000454 2408 pgsc_dm_v3.4
TAATTGTTTTTTTTCCAGGTAAGATCATGGATGGAAGAAGTATACCCTGGCATAAGCAAA
CATATAGTTTCCTATATCATTGGACTGGATAGCCTGAAAGCTGTTAGCATAGATGAAGAT
TTGCCAAGGGATAGTCAAGATATTAGATTACGAATGGATGGTTTATTTGAGAATAAGGAA
CAAGCAATCCACTTTACAAAAGAGTTCATAGCATTATATACAAATGGACCTGCTGGTGGT
GGCGGTATCAGGTCTTATTCATACCATTTATTGTGACATATTTCAGAAAATTGTTGAAAT
GAAAACGGCTATGAGTAAATTTCCTGGTGCGACAGAGGTGAAGCCAGATTTTTTAGTTTA
TTGGTTCTGGATCACAATTCTGTTTGCCTACTGTGTTCTGAATTGATTATAAATTTGTAC
ATATTAAATGCATTTTAATTCAATTACAGGGTTTGAGCCAAAGCTATTGGATTTAGCCGA
ATCCGTGGCCAGCACTGTGGCTCCGCCACTGCTGGTGCCTCAAATTTTTTTCTGTTATAT
TCATTTATCAATAGTTAAGTTGTTGAAGTATTTCTTAGTATTAGAAAGTTGGAAAATTAG
GAAATTTTCTTTCTGTTAGATACCTATCATATAGATTGCTGTAACATAGTGATTTTTCTT
TTGTGGAGAATCCATCTCATCAGGTAAAGGGACTTCATGGTATGATATGCTCTCATAGTA
ATGAGCAATTTGATCTGCACTGTTGTCTTCCATGTGGAAGTTGTAATATCCGTCGCATGT
CTTTTACTAGAGCAGTTTCTTCACTCAAGCACCTAATTTTAATACTACAACTCGATGCAG
CATCAATCTGAGTATATTGAATCATTACCTAATAATGTGTTTTTGAATTTTTTCCATGTG
CAGAACTGTCTTTGTTTTTTGTGGTCACCAATGATCAAAGGCTTGTAATATCCTTCACTT
CATGTTAATAATGAATGTGTCTCTGACTCTGATTATATCCCCCTCCCAGTTTTCCTCTTG
CTAGACTTAATTCCCCTTCTCGATTATGTCAAAACATATTTCCATGACATGTACATTATC
TTCTTTTTAATATGGATAGCTGTCTCAGTATTCCTGCCTCAATTCATTTAATACTTCCGT
ATGTTAAGAACATATTTCTATGACACGTATTAATGCTCTACATCTTCTTTTATTGTATGG
CAGCACTGGACACAAAAAAGACATCATTCTTGAGAAAGCACTGGTATATCTCTCCATCTC
TCTCATATATATGTGTGTGTGCATATGTGTGCTCGCGTATGTGTGTTCACGTGTGTGTGT
GTGTGTGTGTGTTTATGCGTGACACAGATTGACATTCTCTCTCTTTATTGATACTCTGTG
TTATGATATGTATACTTCGCTAGTTGTTAATTTATTAGATTTTTCTCCTATAGCTATTGA
CAGAAAAGAACAAAAGTTCTTTCCTATTGTGAGGTGGTTCCTACCTTGTGGTATTTGATC
TTTCAATGGTTGCTTCATGCTATATTGCTAATACTGTATAAATAAGTTTTAAAGAGTTCT
CTATTATCTTCAGGTAAAACGTAAAGATGTTCAGTGGCATATGACAGCAACAAGAAATAA
AATTATGCAATCAGATGATCTGGCTAGCCCTAAAAACATAATACAGACCAGTTCATTCCA
TGAATCAGTCTTGCAATCACTTACAATGGAAACTACTTTGAATCACAAAGAAGGTTCACC
GCAAATTGAGCTGATCTCCCCTGCTCCACATGACAGGAAGATTCCTCTTTATGATTTTGC
ACATAGCAGAGCTGGTGATAAAGGGGATGATATAAACTTTTCCCTTATCCCATATTTTCC
TCCAGATATTGAAAGGCTTAAGAAGATTGTAACTCAAGAATGGGTGAAAAAAGTTGTCTC
AAGTCTTCTTAATCCCTCTTCTTTTCCCACTTCTGATGATATTGAACAAAGAAACAAATG
GATCAGTGAACATGTTGAAGTGGAGATTTATGAAGTCAGAGGGATCCATTCTTTGAATAT
AGTGGTTCGTAATATCCTAGATGGAGGTGTGAACTGCTCAAGGAGAATCGATAGGCATGG
AAAGACTCTATCCGATCTCATATTGTGCCAGAAAGTGTTATTGCCTCTGTAATTGAACAG
ATGGCAAGACTGGAAAAGACACGCTGACTCCATTTTCTTTATCCTGGGAGGTGATAGTAG
TGACAGTGGGGTGGGGGACAAGCTCCTGGCCTAGCTACAAGTTGGAGTATACCAGAACCT
GAAGACTTACTTTTGAAATAAAATTTGTTGTAGTACCAGTACATGTTCATAAACAAGTTG
TCTGAACTCTTTATTCTGAAATAAAATTACTGTTGCAGAGTTTTTTACTCTTTGTGAAAG
CCATGAAT