- Probe CUST_35853_PI390587928
- Source Contig U35_49529
Probe Details
Probe ID | Chip | Probe Sequence (60 bp) | Probe location | Differentially Expressed |
---|---|---|---|---|
CUST_35853_PI390587928 | Hv_44K_v2 | CCAGTGGTGTACACCTAATCTTCTTGTTGATCTTTCTTTTCTAGAGTGTTTTTGTTATGA | 249 | GeneList: None MasterList: None |
Probe Values
This probe has no recorded values for this experimentProbe Sequence's BLAST hits in Barley Unigene Datasets
Dataset | Hit | Hit Length | E-value | Position on Hit | % Identity | Match | Direction | Probes on Sequence |
---|---|---|---|---|---|---|---|---|
MLOC | MLOC_7963.9 | 6183 | 2e-24 | 3564 - 3623 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.19 | 4817 | 2e-24 | 3104 - 3163 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.15 | 5250 | 2e-24 | 3331 - 3390 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.16 | 5402 | 2e-24 | 3331 - 3390 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.14 | 5130 | 2e-24 | 3331 - 3390 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.24 | 1724 | 2e-24 | 40 - 99 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.23 | 2248 | 2e-24 | 40 - 99 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.2 | 5086 | 2e-24 | 3347 - 3406 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.3 | 6475 | 2e-24 | 3920 - 3979 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.4 | 5709 | 2e-24 | 3347 - 3406 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.21 | 2764 | 2e-24 | 456 - 515 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.6 | 5512 | 2e-24 | 3587 - 3646 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.7 | 5610 | 2e-24 | 3587 - 3646 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.12 | 5369 | 2e-24 | 3386 - 3445 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
MLOC | MLOC_7963.13 | 5633 | 2e-24 | 3386 - 3445 | 100 | 60 / 60 | minus | ABC06593 ABC51294 |
JLOC1 | JLOC1_5273.38 | 5845 | 8e-25 | 2307 - 2366 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.37 | 6006 | 8e-25 | 1895 - 1954 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.36 | 5301 | 8e-25 | 1763 - 1822 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.35 | 4975 | 8e-25 | 1437 - 1496 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.34 | 5505 | 8e-25 | 1967 - 2026 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.33 | 5699 | 8e-25 | 2161 - 2220 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.31 | 5493 | 8e-25 | 1955 - 2014 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.30 | 5344 | 8e-25 | 1806 - 1865 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.29 | 5209 | 8e-25 | 1671 - 1730 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.28 | 5175 | 8e-25 | 1637 - 1696 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.27 | 6009 | 8e-25 | 2471 - 2530 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.25 | 5705 | 8e-25 | 2167 - 2226 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.23 | 6018 | 8e-25 | 2480 - 2539 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.21 | 5719 | 8e-25 | 2181 - 2240 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.20 | 5528 | 8e-25 | 1990 - 2049 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.19 | 4955 | 8e-25 | 1417 - 1476 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.18 | 5227 | 8e-25 | 1689 - 1748 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.17 | 5278 | 8e-25 | 1740 - 1799 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.16 | 5184 | 8e-25 | 1646 - 1705 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.15 | 5016 | 8e-25 | 1478 - 1537 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.13 | 5281 | 8e-25 | 1743 - 1802 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.12 | 5420 | 8e-25 | 1882 - 1941 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.11 | 5696 | 8e-25 | 2158 - 2217 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.10 | 5791 | 8e-25 | 1680 - 1739 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.9 | 5978 | 8e-25 | 1867 - 1926 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.8 | 6312 | 8e-25 | 2201 - 2260 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.7 | 5497 | 8e-25 | 1959 - 2018 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.6 | 5223 | 8e-25 | 1685 - 1744 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.4 | 5106 | 8e-25 | 1568 - 1627 | 100 | 60 / 60 | plus | |
JLOC1 | JLOC1_5273.3 | 5730 | 8e-25 | 2192 - 2251 | 100 | 60 / 60 | plus | |
Harvest21 | ABC51294 | 356 | 3e-25 | 250 - 309 | 100 | 60 / 60 | plus | ABC51294 |
Harvest35 | U35_49529 | 356 | 3e-25 | 250 - 309 | 100 | 60 / 60 | plus |
Contig Sequence (356 bp)
>U35_49529 356 Hv_44K_v2 AGCGGTGCTCCTTGCATCCAGCTATGTGAAACGGACGACCCAACATGGAATTGTTTTGTT CGTACCTTTGAAAGCGACGAGGTCTAGACTGGAACAAATACAACAAGGAAGATATTTTGC TAGAGGAGAAACATGTGAACTTCAGTTCTGTTGAGAGATATGTAAGACGGCTACACATTT GTTTGGGGTAACTTTGATGTATAGACTTGTGCGATCTGTGTGCATAAGATATTACTTTAT CCAGTCTATCCAGTGGTGTACACCTAATCTTCTTGTTGATCTTTCTTTTCTAGAGTGTTT TTGTTATGAACTCTTCCGTGAATTTGGAGTATTTTTTTTCAAAAAAAAAAAAAACC
Homology of Contig U35_49529 to Model Species (E-value threshold 1e-50)
Pseudo-peptide dataset | Hit | Hit length | E-value | Description |
---|---|---|---|---|
Rice v7 | None | |||
Brachypodium v1_2 | None | |||
Arabidopsis v10 | None |