Probe CUST_992_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_992_PI426222305 | JHI_St_60k_v1 | DMT400026205 | CTGTTTGTAATCTTCTTCACACTGTTGTCTCTACTTAAGATGAACTAATAACAACTGCAG |
All Microarray Probes Designed to Gene DMG400010099
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_992_PI426222305 | JHI_St_60k_v1 | DMT400026205 | CTGTTTGTAATCTTCTTCACACTGTTGTCTCTACTTAAGATGAACTAATAACAACTGCAG |
Microarray Signals from CUST_992_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 399.042 | 53.7513 | 1.52572 | 0.158664 |
| ABA 1h | 330.019 | 30.0867 | 1.4404 | 0.159341 |
| ACC 1h | 267.635 | 82.1342 | 0.887405 | 0.305668 |
| BABA 1h | 276.624 | 63.9645 | 1.04823 | 0.171111 |
| Chitin 1h | 173.019 | 27.879 | 0.727042 | 0.135115 |
| Epi 1h | 264.568 | 45.1437 | 1.15746 | 0.198511 |
| SA 1h | 262.254 | 24.3519 | 0.984771 | 0.0746897 |
| Me-JA 1h | 86.3018 | 12.2305 | 0.402603 | 0.0291277 |
| Control 6h | 299.004 | 73.1799 | 1.08493 | 0.211089 |
| ABA 6h | 373.728 | 21.9297 | 1.36739 | 0.0961402 |
| ACC 6h | 225.113 | 25.8904 | 0.752957 | 0.060692 |
| BABA 6h | 253.703 | 37.3005 | 0.862612 | 0.108848 |
| Chitin 6h | 328.589 | 27.717 | 1.19236 | 0.135047 |
| Epi 6h | 304.23 | 25.7899 | 1.04263 | 0.0619628 |
| SA 6h | 237.477 | 42.6615 | 0.899232 | 0.0749658 |
| Me-JA 6h | 225.404 | 56.8697 | 0.828052 | 0.139565 |
Source Transcript PGSC0003DMT400026205 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc02g089650.2 | +2 | 0.0 | 820 | 388/399 (97%) | genomic_reference:SL2.50ch02 gene_region:45984452-45986300 transcript_region:SL2.50ch02:45984452..45986300+ functional_description:Unknown Protein (AHRD V1); contains Interpro domain(s) IPR010683 Protein of unknown function DUF1262 |
| TAIR PP10 | AT1G61600.1 | +2 | 2e-95 | 299 | 175/426 (41%) | Protein of unknown function (DUF1262) | chr1:22729816-22731182 FORWARD LENGTH=421 |