Probe CUST_958_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_958_PI426222305 | JHI_St_60k_v1 | DMT400052060 | AATCAGAAGCAAATTGCCAGATTGGGTGTCGCTAAGGACTTGGGCGATAGTGTTGGATTT |
All Microarray Probes Designed to Gene DMG400020209
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_958_PI426222305 | JHI_St_60k_v1 | DMT400052060 | AATCAGAAGCAAATTGCCAGATTGGGTGTCGCTAAGGACTTGGGCGATAGTGTTGGATTT |
Microarray Signals from CUST_958_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 5.83763 | 3.26619 | 0.393597 | 0.220952 |
| ABA 1h | 6.13551 | 3.16411 | 0.463245 | 0.243696 |
| ACC 1h | 20.0196 | 3.7379 | 1.30851 | 0.246278 |
| BABA 1h | 12.9072 | 3.9584 | 0.812042 | 0.405907 |
| Chitin 1h | 17.3706 | 6.33861 | 1.14856 | 0.504846 |
| Epi 1h | 8.48911 | 3.31606 | 0.602257 | 0.285852 |
| SA 1h | 8.9355 | 3.30199 | 0.578099 | 0.224577 |
| Me-JA 1h | 30.5166 | 3.79634 | 2.49488 | 0.316199 |
| Control 6h | 18.678 | 7.50237 | 1.0192 | 0.479256 |
| ABA 6h | 43.5748 | 18.2472 | 2.17358 | 1.26358 |
| ACC 6h | 24.1904 | 4.38271 | 1.42657 | 0.255294 |
| BABA 6h | 41.8832 | 19.2578 | 2.03425 | 1.08805 |
| Chitin 6h | 10.2081 | 3.74441 | 0.610368 | 0.253654 |
| Epi 6h | 13.0313 | 3.97487 | 0.717263 | 0.271322 |
| SA 6h | 10.837 | 3.5795 | 0.675394 | 0.324115 |
| Me-JA 6h | 33.1312 | 4.77282 | 2.20802 | 0.266499 |
Source Transcript PGSC0003DMT400052060 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc02g094190.2 | +3 | 0.0 | 1081 | 579/591 (98%) | genomic_reference:SL2.50ch02 gene_region:49368076-49371114 transcript_region:SL2.50ch02:49368076..49371114- functional_description:Nodulin family protein (AHRD V1 ***- D7M603_ARALY); contains Interpro domain(s) IPR010658 Nodulin-like |
| TAIR PP10 | AT3G01930.2 | +3 | 0.0 | 825 | 440/591 (74%) | Major facilitator superfamily protein | chr3:319289-321488 REVERSE LENGTH=584 |