Probe CUST_8993_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_8993_PI426222305 | JHI_St_60k_v1 | DMT400048045 | CACATTGCAAATGGTCATAATTTGCTCAAATGGCCATTTGGTTCTCTTCTTAGTACTATT |
All Microarray Probes Designed to Gene DMG400018670
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_8993_PI426222305 | JHI_St_60k_v1 | DMT400048045 | CACATTGCAAATGGTCATAATTTGCTCAAATGGCCATTTGGTTCTCTTCTTAGTACTATT |
Microarray Signals from CUST_8993_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 2501.8 | 248.476 | 0.674676 | 0.0389658 |
| ABA 1h | 5686.05 | 649.818 | 1.72475 | 0.129071 |
| ACC 1h | 1134.24 | 203.62 | 0.289934 | 0.0366177 |
| BABA 1h | 2724.76 | 592.636 | 0.728358 | 0.104792 |
| Chitin 1h | 2908.71 | 233.378 | 0.875035 | 0.0505319 |
| Epi 1h | 2104.6 | 268.436 | 0.651575 | 0.064666 |
| SA 1h | 2858.65 | 250.613 | 0.751943 | 0.0434243 |
| Me-JA 1h | 2146.94 | 299.121 | 0.702071 | 0.040554 |
| Control 6h | 4872.73 | 948.448 | 1.26413 | 0.164347 |
| ABA 6h | 10897.3 | 1837.55 | 2.69903 | 0.39349 |
| ACC 6h | 4731.82 | 274.116 | 1.11901 | 0.107571 |
| BABA 6h | 4783.05 | 306.312 | 1.1585 | 0.0792167 |
| Chitin 6h | 4711.33 | 588.925 | 1.18627 | 0.129012 |
| Epi 6h | 5189.65 | 300.411 | 1.24961 | 0.0721555 |
| SA 6h | 5388.21 | 729.504 | 1.45422 | 0.0839681 |
| Me-JA 6h | 5347.63 | 694.535 | 1.43453 | 0.0950921 |
Source Transcript PGSC0003DMT400048045 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G42005.1 | +1 | 0.0 | 550 | 282/410 (69%) | Transmembrane amino acid transporter family protein | chr2:17531323-17532564 REVERSE LENGTH=413 |