Probe CUST_8189_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_8189_PI426222305 | JHI_St_60k_v1 | DMT400030214 | CTTCTTTACTTCCTAATACAACAACTACTACGTCTCAATCCCAAACTTCTAGTTGCTAAT |
All Microarray Probes Designed to Gene DMG400011560
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_8189_PI426222305 | JHI_St_60k_v1 | DMT400030214 | CTTCTTTACTTCCTAATACAACAACTACTACGTCTCAATCCCAAACTTCTAGTTGCTAAT |
Microarray Signals from CUST_8189_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 404.345 | 23.5859 | 1.51741 | 0.0882578 |
| ABA 1h | 610.855 | 45.2784 | 2.58436 | 0.149675 |
| ACC 1h | 405.813 | 56.7326 | 1.4553 | 0.104107 |
| BABA 1h | 337.902 | 54.9538 | 1.27966 | 0.0956786 |
| Chitin 1h | 254.54 | 61.2555 | 1.00478 | 0.219255 |
| Epi 1h | 298.702 | 27.9117 | 1.28716 | 0.155904 |
| SA 1h | 417.695 | 83.0659 | 1.46594 | 0.223471 |
| Me-JA 1h | 202.632 | 12.0888 | 0.931679 | 0.055451 |
| Control 6h | 165.26 | 37.0696 | 0.584408 | 0.100845 |
| ABA 6h | 470.332 | 63.2653 | 1.63578 | 0.126388 |
| ACC 6h | 175.905 | 12.0602 | 0.574324 | 0.0510966 |
| BABA 6h | 134.985 | 12.3427 | 0.450235 | 0.0369736 |
| Chitin 6h | 144.285 | 8.97186 | 0.509088 | 0.0316131 |
| Epi 6h | 172.373 | 15.4768 | 0.570456 | 0.034821 |
| SA 6h | 223.934 | 18.4545 | 0.846391 | 0.119408 |
| Me-JA 6h | 164.688 | 46.0892 | 0.57886 | 0.111728 |
Source Transcript PGSC0003DMT400030214 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G37360.1 | +3 | 7e-147 | 437 | 228/445 (51%) | cytochrome P450, family 81, subfamily D, polypeptide 2 | chr4:17567124-17568858 REVERSE LENGTH=499 |