Probe CUST_7011_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_7011_PI426222305 | JHI_St_60k_v1 | DMT400044938 | TTCCCTACCATTGTCAATTCTTCTATGTTTCAATGCCTTGGCAGTACCAGCCAACAAATA |
All Microarray Probes Designed to Gene DMG400017432
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_7011_PI426222305 | JHI_St_60k_v1 | DMT400044938 | TTCCCTACCATTGTCAATTCTTCTATGTTTCAATGCCTTGGCAGTACCAGCCAACAAATA |
Microarray Signals from CUST_7011_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 5.40317 | 3.1369 | 0.408848 | 0.237145 |
| ABA 1h | 17.1027 | 9.28375 | 1.07276 | 0.735737 |
| ACC 1h | 14.8614 | 6.86837 | 0.899084 | 0.400147 |
| BABA 1h | 14.212 | 4.98389 | 0.953767 | 0.332915 |
| Chitin 1h | 11.158 | 3.19554 | 0.908281 | 0.285324 |
| Epi 1h | 10.8852 | 3.14354 | 0.942868 | 0.280817 |
| SA 1h | 18.417 | 3.28575 | 1.35519 | 0.242488 |
| Me-JA 1h | 12.7566 | 3.86171 | 1.06205 | 0.371477 |
| Control 6h | 5.59047 | 3.24223 | 0.422394 | 0.244944 |
| ABA 6h | 120.799 | 48.7283 | 6.58288 | 4.38991 |
| ACC 6h | 43.3332 | 10.4321 | 2.67253 | 0.487283 |
| BABA 6h | 66.8698 | 31.3183 | 3.70108 | 1.6878 |
| Chitin 6h | 6.26291 | 3.58973 | 0.445313 | 0.255185 |
| Epi 6h | 6.43949 | 3.7593 | 0.429166 | 0.248553 |
| SA 6h | 13.2722 | 7.38155 | 0.758677 | 0.681941 |
| Me-JA 6h | 16.0596 | 5.67938 | 1.01263 | 0.449089 |
Source Transcript PGSC0003DMT400044938 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G13080.1 | +1 | 0.0 | 1184 | 642/1299 (49%) | multidrug resistance-associated protein 3 | chr3:4196019-4201250 REVERSE LENGTH=1514 |