Probe CUST_6768_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_6768_PI426222305 | JHI_St_60k_v1 | DMT400014770 | GAATCCTCTCTTCTTCATCATCTTTTATGCACAAGAGTGCAGATCCATCTCAATATTTCA |
All Microarray Probes Designed to Gene DMG400005756
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_6768_PI426222305 | JHI_St_60k_v1 | DMT400014770 | GAATCCTCTCTTCTTCATCATCTTTTATGCACAAGAGTGCAGATCCATCTCAATATTTCA |
Microarray Signals from CUST_6768_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 5.22198 | 3.02749 | 0.898632 | 0.515987 |
| ABA 1h | 8.53775 | 3.40517 | 1.42847 | 0.663 |
| ACC 1h | 7.64184 | 3.41197 | 1.21874 | 0.597035 |
| BABA 1h | 5.47529 | 3.17655 | 0.968516 | 0.560865 |
| Chitin 1h | 6.39295 | 3.05831 | 1.19216 | 0.597727 |
| Epi 1h | 7.56569 | 3.02279 | 1.37052 | 0.641452 |
| SA 1h | 5.21055 | 3.02385 | 0.865615 | 0.501904 |
| Me-JA 1h | 5.34575 | 3.11085 | 1.11597 | 0.645758 |
| Control 6h | 5.78529 | 3.16924 | 0.984257 | 0.541581 |
| ABA 6h | 48.5666 | 6.38109 | 7.67698 | 0.69674 |
| ACC 6h | 6.49228 | 3.86214 | 0.946034 | 0.550043 |
| BABA 6h | 7.03004 | 3.52623 | 1.07106 | 0.539865 |
| Chitin 6h | 7.46616 | 3.49507 | 1.16174 | 0.58197 |
| Epi 6h | 8.21323 | 3.65967 | 1.19941 | 0.582534 |
| SA 6h | 5.77089 | 3.30446 | 0.996021 | 0.57034 |
| Me-JA 6h | 9.17523 | 3.19447 | 1.44868 | 0.596253 |
Source Transcript PGSC0003DMT400014770 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |