Probe CUST_51646_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_51646_PI426222305 | JHI_St_60k_v1 | DMT400011412 | CCACCAACATCATCCCCTCGACCTCTAGTTATCGTGAAGAATGAAGATAGTACGAAATAT |
All Microarray Probes Designed to Gene DMG400004472
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_51646_PI426222305 | JHI_St_60k_v1 | DMT400011412 | CCACCAACATCATCCCCTCGACCTCTAGTTATCGTGAAGAATGAAGATAGTACGAAATAT |
Microarray Signals from CUST_51646_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 10.0654 | 4.15705 | 0.710533 | 0.331173 |
| ABA 1h | 381.648 | 22.34 | 35.4659 | 2.14624 |
| ACC 1h | 8.71179 | 3.7507 | 0.659881 | 0.320766 |
| BABA 1h | 10.794 | 3.70286 | 0.873045 | 0.34734 |
| Chitin 1h | 11.0986 | 3.56186 | 0.92255 | 0.356768 |
| Epi 1h | 11.1718 | 3.65274 | 0.958618 | 0.379726 |
| SA 1h | 14.9874 | 3.48571 | 1.16136 | 0.296286 |
| Me-JA 1h | 13.7663 | 4.90198 | 1.2268 | 0.622991 |
| Control 6h | 14.7329 | 4.05734 | 1.0945 | 0.382071 |
| ABA 6h | 129.45 | 24.7377 | 9.64499 | 1.74308 |
| ACC 6h | 8.07961 | 4.38983 | 0.573841 | 0.305615 |
| BABA 6h | 18.9489 | 4.30267 | 1.3798 | 0.313608 |
| Chitin 6h | 7.93334 | 4.18636 | 0.606061 | 0.325908 |
| Epi 6h | 14.1968 | 4.33245 | 0.986122 | 0.326713 |
| SA 6h | 15.6039 | 4.43316 | 1.16561 | 0.590259 |
| Me-JA 6h | 10.3903 | 3.80066 | 0.81689 | 0.335983 |
Source Transcript PGSC0003DMT400011412 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G42565.1 | +1 | 4e-17 | 74 | 37/75 (49%) | ECA1 gametogenesis related family protein | chr3:14683051-14683410 REVERSE LENGTH=119 |