Probe CUST_51519_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_51519_PI426222305 | JHI_St_60k_v1 | DMT400031363 | GGCTTTAATCAACAGTCTTGCTGCCCTTCACGGCTAAAGTAATTTGAAACGACAATTAAA |
All Microarray Probes Designed to Gene DMG400012020
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_51519_PI426222305 | JHI_St_60k_v1 | DMT400031363 | GGCTTTAATCAACAGTCTTGCTGCCCTTCACGGCTAAAGTAATTTGAAACGACAATTAAA |
Microarray Signals from CUST_51519_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 542.664 | 31.5757 | 0.133608 | 0.00775285 |
| ABA 1h | 872.943 | 217.342 | 0.225937 | 0.0579266 |
| ACC 1h | 2034.28 | 685.126 | 0.436771 | 0.130947 |
| BABA 1h | 3067.65 | 628.559 | 0.75269 | 0.095814 |
| Chitin 1h | 2002.62 | 177.085 | 0.545759 | 0.0551584 |
| Epi 1h | 1783.69 | 300.549 | 0.495367 | 0.0930978 |
| SA 1h | 2671.05 | 834.602 | 0.575754 | 0.169127 |
| Me-JA 1h | 3627.98 | 641.668 | 1.06505 | 0.0933596 |
| Control 6h | 10741.1 | 3019.37 | 2.37613 | 0.638092 |
| ABA 6h | 5547.03 | 1683.47 | 1.15882 | 0.348033 |
| ACC 6h | 18147.2 | 2207.94 | 3.84476 | 0.450388 |
| BABA 6h | 16441 | 2430.54 | 3.54928 | 0.486205 |
| Chitin 6h | 9179.93 | 570.272 | 2.12074 | 0.122444 |
| Epi 6h | 7491.65 | 1724.12 | 1.56098 | 0.396374 |
| SA 6h | 8198.78 | 1287.12 | 1.9921 | 0.129524 |
| Me-JA 6h | 17139.8 | 2303.23 | 4.17786 | 0.685649 |
Source Transcript PGSC0003DMT400031363 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G62360.1 | +1 | 1e-59 | 190 | 105/197 (53%) | Plant invertase/pectin methylesterase inhibitor superfamily protein | chr5:25040699-25041310 FORWARD LENGTH=203 |