Probe CUST_50295_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_50295_PI426222305 | JHI_St_60k_v1 | DMT400044079 | CAAGCCATAACTATGCCAGATCATTACCTCGACTATGTTCTTGAATGATATTATGAAATC |
All Microarray Probes Designed to Gene DMG400017103
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_50295_PI426222305 | JHI_St_60k_v1 | DMT400044079 | CAAGCCATAACTATGCCAGATCATTACCTCGACTATGTTCTTGAATGATATTATGAAATC |
Microarray Signals from CUST_50295_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 898.876 | 59.1744 | 1.96981 | 0.113903 |
| ABA 1h | 658.731 | 273.486 | 1.32639 | 0.700852 |
| ACC 1h | 769.598 | 252.056 | 1.40075 | 0.569357 |
| BABA 1h | 606.914 | 121.207 | 1.3203 | 0.16541 |
| Chitin 1h | 426.384 | 48.6905 | 1.03055 | 0.0599099 |
| Epi 1h | 692.787 | 124.494 | 1.70935 | 0.308246 |
| SA 1h | 443.34 | 130.902 | 0.846595 | 0.289627 |
| Me-JA 1h | 316.012 | 26.4482 | 0.845984 | 0.0494727 |
| Control 6h | 458.684 | 152.803 | 0.876175 | 0.294212 |
| ABA 6h | 640.937 | 52.5708 | 1.31768 | 0.117235 |
| ACC 6h | 382.581 | 63.4677 | 0.715569 | 0.0418327 |
| BABA 6h | 461.345 | 86.2334 | 0.873061 | 0.151585 |
| Chitin 6h | 476.106 | 35.049 | 0.978892 | 0.0804842 |
| Epi 6h | 481.721 | 28.073 | 0.938605 | 0.108506 |
| SA 6h | 346.286 | 21.1702 | 0.767785 | 0.139876 |
| Me-JA 6h | 264.748 | 59.2344 | 0.550184 | 0.101408 |
Source Transcript PGSC0003DMT400044079 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G22104.1 | +1 | 2e-17 | 81 | 47/105 (45%) | Phototropic-responsive NPH3 family protein | chr3:7789814-7792179 FORWARD LENGTH=506 |