Probe CUST_46761_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_46761_PI426222305 | JHI_St_60k_v1 | DMT400038298 | TCTGCTGCTGTTTTTGGGATGCTGCTACAACTGTTTCTTGAGGCTATGATATTCGGATAT |
All Microarray Probes Designed to Gene DMG400014780
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_46761_PI426222305 | JHI_St_60k_v1 | DMT400038298 | TCTGCTGCTGTTTTTGGGATGCTGCTACAACTGTTTCTTGAGGCTATGATATTCGGATAT |
Microarray Signals from CUST_46761_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 22.8991 | 3.80228 | 1.74718 | 0.298907 |
| ABA 1h | 24.5995 | 5.32864 | 2.03992 | 0.35481 |
| ACC 1h | 13.5247 | 4.67134 | 1.00426 | 0.373035 |
| BABA 1h | 9.32533 | 3.77271 | 0.713095 | 0.319154 |
| Chitin 1h | 6.12365 | 3.55504 | 0.525232 | 0.304251 |
| Epi 1h | 10.4409 | 4.25185 | 0.802328 | 0.370634 |
| SA 1h | 17.8701 | 8.36355 | 1.05901 | 0.59464 |
| Me-JA 1h | 7.91361 | 3.70024 | 0.713261 | 0.36 |
| Control 6h | 12.6833 | 3.69011 | 0.948229 | 0.300525 |
| ABA 6h | 24.3892 | 5.08114 | 1.69531 | 0.333372 |
| ACC 6h | 8.6466 | 4.5904 | 0.577656 | 0.294467 |
| BABA 6h | 22.1159 | 4.2244 | 1.46997 | 0.300619 |
| Chitin 6h | 17.6042 | 4.12076 | 1.27128 | 0.30311 |
| Epi 6h | 20.0105 | 6.67546 | 1.23717 | 0.392003 |
| SA 6h | 12.6287 | 4.70187 | 0.868208 | 0.357569 |
| Me-JA 6h | 12.4129 | 3.71691 | 0.903191 | 0.317596 |
Source Transcript PGSC0003DMT400038298 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |