Probe CUST_46709_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_46709_PI426222305 | JHI_St_60k_v1 | DMT400024385 | GTCTTGTCCTGAAGATGTAGATGAGTTTTGTACTCAGTTGGATGCATCTCCACACCAAAG |
All Microarray Probes Designed to Gene DMG400009427
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_46709_PI426222305 | JHI_St_60k_v1 | DMT400024385 | GTCTTGTCCTGAAGATGTAGATGAGTTTTGTACTCAGTTGGATGCATCTCCACACCAAAG |
Microarray Signals from CUST_46709_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 131.958 | 14.8277 | 0.825954 | 0.0680438 |
| ABA 1h | 90.4176 | 13.074 | 0.633189 | 0.0559679 |
| ACC 1h | 187.531 | 46.6518 | 1.07061 | 0.242371 |
| BABA 1h | 148.309 | 9.14235 | 0.971514 | 0.0615832 |
| Chitin 1h | 86.5444 | 11.1674 | 0.599525 | 0.0404993 |
| Epi 1h | 102.065 | 12.1033 | 0.737365 | 0.0915157 |
| SA 1h | 176.452 | 36.594 | 1.04163 | 0.268508 |
| Me-JA 1h | 329.931 | 37.2741 | 2.52634 | 0.223184 |
| Control 6h | 159.384 | 55.9787 | 0.830279 | 0.365629 |
| ABA 6h | 235.615 | 27.434 | 1.38502 | 0.211196 |
| ACC 6h | 222.887 | 42.9264 | 1.18276 | 0.178438 |
| BABA 6h | 225.905 | 33.0085 | 1.25346 | 0.146687 |
| Chitin 6h | 169.65 | 10.3725 | 1.00947 | 0.0617186 |
| Epi 6h | 165.922 | 42.8849 | 0.877655 | 0.225522 |
| SA 6h | 104.741 | 32.0835 | 0.592322 | 0.163527 |
| Me-JA 6h | 333.679 | 19.5316 | 2.12082 | 0.209526 |
Source Transcript PGSC0003DMT400024385 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G14130.1 | +3 | 2e-115 | 343 | 174/295 (59%) | 2-oxoglutarate (2OG) and Fe(II)-dependent oxygenase superfamily protein | chr1:4836041-4837040 REVERSE LENGTH=308 |