Probe CUST_44696_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_44696_PI426222305 | JHI_St_60k_v1 | DMT400091565 | AAAGAGCCGGTGATGTACTGCAACGATTGCAAACTCTTCTTCCCTCAATCTCTAACTCCT |
All Microarray Probes Designed to Gene DMG400041136
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_44696_PI426222305 | JHI_St_60k_v1 | DMT400091565 | AAAGAGCCGGTGATGTACTGCAACGATTGCAAACTCTTCTTCCCTCAATCTCTAACTCCT |
Microarray Signals from CUST_44696_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 358.483 | 20.9868 | 1.53484 | 0.0896112 |
| ABA 1h | 261.99 | 35.3091 | 1.24948 | 0.162585 |
| ACC 1h | 236.748 | 86.0401 | 0.817729 | 0.373498 |
| BABA 1h | 212.115 | 45.8924 | 0.898221 | 0.124645 |
| Chitin 1h | 149.146 | 20.8681 | 0.696863 | 0.113065 |
| Epi 1h | 216.676 | 30.4303 | 1.05418 | 0.149 |
| SA 1h | 264.748 | 32.1686 | 1.08942 | 0.104156 |
| Me-JA 1h | 114.671 | 7.34006 | 0.60195 | 0.0384233 |
| Control 6h | 241.485 | 38.7807 | 1.00964 | 0.127289 |
| ABA 6h | 241.115 | 20.1967 | 0.967058 | 0.0772847 |
| ACC 6h | 260.514 | 15.562 | 0.972072 | 0.102417 |
| BABA 6h | 246.788 | 28.3307 | 0.934145 | 0.127251 |
| Chitin 6h | 269.493 | 15.9967 | 1.08347 | 0.0641259 |
| Epi 6h | 264.504 | 17.5578 | 1.00265 | 0.0595098 |
| SA 6h | 249.865 | 23.8551 | 1.07514 | 0.0860332 |
| Me-JA 6h | 212.752 | 33.3521 | 0.895347 | 0.0659146 |
Source Transcript PGSC0003DMT400091565 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G44414.1 | +1 | 6e-54 | 167 | 75/107 (70%) | unknown protein; Has 29 Blast hits to 29 proteins in 12 species: Archae - 0; Bacteria - 4; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr1:16847781-16848086 FORWARD LENGTH=101 |