Probe CUST_44382_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_44382_PI426222305 | JHI_St_60k_v1 | DMT400090681 | GCGACTAATTTATTCATGACACCAATCATGTTTGACGTTTGTACAAATCACGATTTTCCA |
All Microarray Probes Designed to Gene DMG400040252
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_44382_PI426222305 | JHI_St_60k_v1 | DMT400090681 | GCGACTAATTTATTCATGACACCAATCATGTTTGACGTTTGTACAAATCACGATTTTCCA |
Microarray Signals from CUST_44382_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 45.8257 | 13.2905 | 2.11294 | 0.860682 |
| ABA 1h | 37.9972 | 11.6278 | 2.00922 | 0.489262 |
| ACC 1h | 40.1573 | 29.0745 | 1.14509 | 1.20175 |
| BABA 1h | 65.9477 | 5.46519 | 3.49472 | 0.290413 |
| Chitin 1h | 23.4067 | 5.84597 | 1.24037 | 0.421464 |
| Epi 1h | 35.9307 | 12.6391 | 1.84333 | 0.80841 |
| SA 1h | 116.894 | 53.7258 | 4.68999 | 2.84483 |
| Me-JA 1h | 227.456 | 32.1748 | 14.014 | 1.74361 |
| Control 6h | 8.73831 | 3.87542 | 0.427341 | 0.209524 |
| ABA 6h | 10.6214 | 3.98206 | 0.480521 | 0.207456 |
| ACC 6h | 8.11197 | 4.81523 | 0.354582 | 0.205368 |
| BABA 6h | 22.907 | 16.1021 | 0.625937 | 0.605374 |
| Chitin 6h | 7.35366 | 4.20815 | 0.353912 | 0.202497 |
| Epi 6h | 8.91479 | 4.7702 | 0.403558 | 0.214222 |
| SA 6h | 7.53555 | 4.09499 | 0.388492 | 0.212929 |
| Me-JA 6h | 129.174 | 37.071 | 6.17966 | 1.70854 |
Source Transcript PGSC0003DMT400090681 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |