Probe CUST_43666_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_43666_PI426222305 | JHI_St_60k_v1 | DMT400004816 | GGTTTAGTTATGACTAGAGCTCAACATCTAATGGTTATTCCTACTTATCGTCTGAATGTA |
All Microarray Probes Designed to Gene DMG400001915
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_43666_PI426222305 | JHI_St_60k_v1 | DMT400004816 | GGTTTAGTTATGACTAGAGCTCAACATCTAATGGTTATTCCTACTTATCGTCTGAATGTA |
Microarray Signals from CUST_43666_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1248.31 | 204.52 | 0.374062 | 0.0740262 |
| ABA 1h | 876.112 | 270.892 | 0.280897 | 0.0657986 |
| ACC 1h | 1343.55 | 302.604 | 0.386034 | 0.0817204 |
| BABA 1h | 3148.81 | 764.184 | 0.941676 | 0.167756 |
| Chitin 1h | 3168.37 | 183.255 | 1.08749 | 0.0698943 |
| Epi 1h | 1620.88 | 393.696 | 0.541801 | 0.137527 |
| SA 1h | 2667.76 | 213.579 | 0.797374 | 0.0460458 |
| Me-JA 1h | 6536.29 | 1014.64 | 2.42041 | 0.201993 |
| Control 6h | 6381.36 | 1522.09 | 1.86662 | 0.305 |
| ABA 6h | 3094.17 | 406.737 | 0.884037 | 0.10231 |
| ACC 6h | 3778.67 | 218.486 | 1.01692 | 0.107256 |
| BABA 6h | 3219.29 | 382.323 | 0.875447 | 0.0812851 |
| Chitin 6h | 3729.9 | 215.834 | 1.08094 | 0.0624165 |
| Epi 6h | 5636.8 | 1093.78 | 1.48014 | 0.423308 |
| SA 6h | 4138.46 | 676.948 | 1.25419 | 0.0807751 |
| Me-JA 6h | 7241.11 | 1606.22 | 2.1144 | 0.391967 |
Source Transcript PGSC0003DMT400004816 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G26210.1 | +1 | 5e-108 | 340 | 189/463 (41%) | cytochrome P450, family 71, subfamily B, polypeptide 23 | chr3:9593329-9595202 REVERSE LENGTH=501 |