Probe CUST_43321_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_43321_PI426222305 | JHI_St_60k_v1 | DMT400064406 | GGAGTTGTCTTTATTATGCAAAATCTTGTTTCTATACGATCGATCATTCGACTACAAGAG |
All Microarray Probes Designed to Gene DMG400025024
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_43321_PI426222305 | JHI_St_60k_v1 | DMT400064406 | GGAGTTGTCTTTATTATGCAAAATCTTGTTTCTATACGATCGATCATTCGACTACAAGAG |
Microarray Signals from CUST_43321_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 906.284 | 158.834 | 1.17003 | 0.123261 |
| ABA 1h | 768.095 | 195.395 | 1.07967 | 0.209655 |
| ACC 1h | 1229.89 | 329.934 | 1.46263 | 0.353356 |
| BABA 1h | 1028.36 | 252.913 | 1.31723 | 0.244001 |
| Chitin 1h | 851.714 | 84.3688 | 1.24648 | 0.0721403 |
| Epi 1h | 785.135 | 104.028 | 1.18503 | 0.122964 |
| SA 1h | 1315.34 | 263.138 | 1.63273 | 0.234526 |
| Me-JA 1h | 875.089 | 133.369 | 1.39251 | 0.0894941 |
| Control 6h | 451.312 | 100.783 | 0.564109 | 0.0961358 |
| ABA 6h | 966.893 | 233.263 | 1.14528 | 0.202989 |
| ACC 6h | 670.188 | 81.3174 | 0.765419 | 0.0444438 |
| BABA 6h | 938.758 | 223.232 | 1.05844 | 0.209211 |
| Chitin 6h | 457.318 | 37.3575 | 0.567008 | 0.0387583 |
| Epi 6h | 410.887 | 37.1842 | 0.480033 | 0.0281097 |
| SA 6h | 468.599 | 58.9783 | 0.618454 | 0.0360805 |
| Me-JA 6h | 773.634 | 226.564 | 0.955004 | 0.198885 |
Source Transcript PGSC0003DMT400064406 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G54470.1 | +3 | 8e-29 | 112 | 51/76 (67%) | B-box type zinc finger family protein | chr5:22114584-22115315 REVERSE LENGTH=215 |