Probe CUST_42762_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_42762_PI426222305 | JHI_St_60k_v1 | DMT400033749 | TCAAGTACTGAGCAAATCTCAAGTTGCACAAACAAGAACAACAGAGTTGATTCAACAAAT |
All Microarray Probes Designed to Gene DMG400012964
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_42762_PI426222305 | JHI_St_60k_v1 | DMT400033749 | TCAAGTACTGAGCAAATCTCAAGTTGCACAAACAAGAACAACAGAGTTGATTCAACAAAT |
Microarray Signals from CUST_42762_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1682.94 | 97.5223 | 1.56586 | 0.0904699 |
| ABA 1h | 3543.55 | 489.528 | 3.66732 | 0.467079 |
| ACC 1h | 1637.85 | 662.521 | 1.14936 | 0.685221 |
| BABA 1h | 1373.16 | 386.186 | 1.20125 | 0.292617 |
| Chitin 1h | 1069.26 | 310.946 | 1.01871 | 0.275637 |
| Epi 1h | 1142.27 | 104.804 | 1.22129 | 0.113935 |
| SA 1h | 2083.32 | 456.886 | 1.78172 | 0.378072 |
| Me-JA 1h | 736.59 | 69.3654 | 0.83391 | 0.0483455 |
| Control 6h | 539.392 | 76.548 | 0.492852 | 0.0664169 |
| ABA 6h | 2518.29 | 632.214 | 2.0441 | 0.519857 |
| ACC 6h | 1343.64 | 167.103 | 1.07716 | 0.252659 |
| BABA 6h | 1062.2 | 112.69 | 0.874895 | 0.102993 |
| Chitin 6h | 821.797 | 97.0522 | 0.710507 | 0.107486 |
| Epi 6h | 737.272 | 314.55 | 0.515226 | 0.185825 |
| SA 6h | 615.685 | 184.676 | 0.516652 | 0.133834 |
| Me-JA 6h | 735.881 | 244.941 | 0.613596 | 0.213321 |
Source Transcript PGSC0003DMT400033749 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G68620.1 | +3 | 2e-113 | 340 | 172/343 (50%) | alpha/beta-Hydrolases superfamily protein | chr1:25766018-25767028 FORWARD LENGTH=336 |