Probe CUST_41683_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_41683_PI426222305 | JHI_St_60k_v1 | DMT400014094 | CTTTGGATACGGTCTTTAGAAAGTTGATTTGGCTTTTGCTTGTACAAATGATGGTTCAAT |
All Microarray Probes Designed to Gene DMG400005526
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_41683_PI426222305 | JHI_St_60k_v1 | DMT400014094 | CTTTGGATACGGTCTTTAGAAAGTTGATTTGGCTTTTGCTTGTACAAATGATGGTTCAAT |
Microarray Signals from CUST_41683_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 136.358 | 15.7724 | 1.21377 | 0.127111 |
| ABA 1h | 68.6922 | 18.4871 | 0.636951 | 0.189284 |
| ACC 1h | 55.4561 | 24.3525 | 0.381648 | 0.206153 |
| BABA 1h | 125.407 | 39.3815 | 1.01485 | 0.339056 |
| Chitin 1h | 91.0438 | 27.4326 | 0.830568 | 0.248034 |
| Epi 1h | 80.0328 | 20.071 | 0.768158 | 0.23693 |
| SA 1h | 82.8436 | 9.75648 | 0.717876 | 0.049415 |
| Me-JA 1h | 57.0651 | 32.0467 | 0.450691 | 0.302194 |
| Control 6h | 282.721 | 82.5722 | 2.35487 | 0.66214 |
| ABA 6h | 33.979 | 3.91607 | 0.284785 | 0.0340009 |
| ACC 6h | 164.049 | 56.5968 | 1.1577 | 0.533261 |
| BABA 6h | 131.306 | 32.1413 | 1.0024 | 0.228665 |
| Chitin 6h | 188.306 | 34.8812 | 1.54595 | 0.239051 |
| Epi 6h | 214.322 | 63.3334 | 1.56754 | 0.368776 |
| SA 6h | 222.589 | 51.1318 | 1.90657 | 0.282419 |
| Me-JA 6h | 107.616 | 22.4433 | 0.932069 | 0.122107 |
Source Transcript PGSC0003DMT400014094 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G46660.1 | +2 | 7e-131 | 388 | 187/277 (68%) | cytochrome P450, family 78, subfamily A, polypeptide 6 | chr2:19153602-19155417 REVERSE LENGTH=530 |