Probe CUST_40918_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_40918_PI426222305 | JHI_St_60k_v1 | DMT400019241 | CGTCTGCTCCTAGTCGATACATAAATGATCAAACTTTAGGTACAACAATTTGTTCATCAA |
All Microarray Probes Designed to Gene DMG400007440
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_40918_PI426222305 | JHI_St_60k_v1 | DMT400019241 | CGTCTGCTCCTAGTCGATACATAAATGATCAAACTTTAGGTACAACAATTTGTTCATCAA |
Microarray Signals from CUST_40918_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 201.126 | 26.6969 | 1.00036 | 0.124779 |
| ABA 1h | 1006.53 | 202.339 | 5.49403 | 0.931578 |
| ACC 1h | 129.549 | 47.4047 | 0.521837 | 0.248595 |
| BABA 1h | 238.936 | 40.7427 | 1.21395 | 0.104032 |
| Chitin 1h | 135.903 | 33.2382 | 0.720878 | 0.158512 |
| Epi 1h | 170.771 | 25.0622 | 0.976439 | 0.146466 |
| SA 1h | 256.94 | 34.6979 | 1.24338 | 0.15913 |
| Me-JA 1h | 94.2031 | 23.5248 | 0.54597 | 0.13971 |
| Control 6h | 109.022 | 12.926 | 0.543099 | 0.0366252 |
| ABA 6h | 2619.08 | 685.534 | 11.613 | 2.59761 |
| ACC 6h | 281.638 | 16.8892 | 1.23966 | 0.215423 |
| BABA 6h | 227.96 | 54.8832 | 0.97646 | 0.195258 |
| Chitin 6h | 275.253 | 25.3622 | 1.29891 | 0.160985 |
| Epi 6h | 177.843 | 11.0892 | 0.797204 | 0.0976093 |
| SA 6h | 247.06 | 47.7942 | 1.22056 | 0.260109 |
| Me-JA 6h | 174.673 | 54.2433 | 0.808628 | 0.186943 |
Source Transcript PGSC0003DMT400019241 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |