Probe CUST_40894_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_40894_PI426222305 | JHI_St_60k_v1 | DMT400079820 | GATTGGATCATTTCGGAGCAGCCTGTAATGCTTGAGGATCTTCACCATGCCATTTCAAAG |
All Microarray Probes Designed to Gene DMG400031081
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_40894_PI426222305 | JHI_St_60k_v1 | DMT400079820 | GATTGGATCATTTCGGAGCAGCCTGTAATGCTTGAGGATCTTCACCATGCCATTTCAAAG |
Microarray Signals from CUST_40894_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 3054.68 | 180.465 | 1.73062 | 0.0999361 |
| ABA 1h | 2698.31 | 156.172 | 1.73041 | 0.0999269 |
| ACC 1h | 2604.58 | 571.699 | 1.35743 | 0.249648 |
| BABA 1h | 2046.89 | 559.778 | 1.11425 | 0.22707 |
| Chitin 1h | 1482.4 | 85.9064 | 0.934369 | 0.0539873 |
| Epi 1h | 1745.28 | 143.045 | 1.13905 | 0.100861 |
| SA 1h | 2313.94 | 426.269 | 1.22987 | 0.198048 |
| Me-JA 1h | 1150.71 | 66.6354 | 0.800025 | 0.0545741 |
| Control 6h | 1644.72 | 367.763 | 0.877024 | 0.147282 |
| ABA 6h | 1752.42 | 517.648 | 0.827562 | 0.302227 |
| ACC 6h | 2076.26 | 292.661 | 1.00984 | 0.0583387 |
| BABA 6h | 1862.7 | 259.919 | 0.927405 | 0.109778 |
| Chitin 6h | 1470.61 | 202.364 | 0.769292 | 0.122443 |
| Epi 6h | 1645.37 | 378.128 | 0.790735 | 0.178201 |
| SA 6h | 1176.03 | 363.029 | 0.619167 | 0.182851 |
| Me-JA 6h | 1454.1 | 326.243 | 0.785412 | 0.124371 |
Source Transcript PGSC0003DMT400079820 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G10420.2 | +2 | 2e-180 | 548 | 301/423 (71%) | P-loop containing nucleoside triphosphate hydrolases superfamily protein | chr3:3239307-3242274 FORWARD LENGTH=684 |