Probe CUST_39618_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_39618_PI426222305 | JHI_St_60k_v1 | DMT400058776 | ATCCACACATATTTCTGGTGAATTAGTGCCAATACTAAAAGATGTTGGAGCTTTATGGCT |
All Microarray Probes Designed to Gene DMG400022834
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_39618_PI426222305 | JHI_St_60k_v1 | DMT400058776 | ATCCACACATATTTCTGGTGAATTAGTGCCAATACTAAAAGATGTTGGAGCTTTATGGCT |
Microarray Signals from CUST_39618_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 252.188 | 45.0425 | 0.829353 | 0.0917626 |
| ABA 1h | 176.664 | 14.8262 | 0.673049 | 0.0402571 |
| ACC 1h | 260.822 | 79.6572 | 0.759556 | 0.245568 |
| BABA 1h | 199.998 | 24.1971 | 0.692739 | 0.0414401 |
| Chitin 1h | 176.494 | 31.8334 | 0.645636 | 0.110666 |
| Epi 1h | 169.172 | 10.1652 | 0.663029 | 0.0398397 |
| SA 1h | 521.159 | 50.0212 | 1.70635 | 0.173036 |
| Me-JA 1h | 124.749 | 7.7876 | 0.516541 | 0.063267 |
| Control 6h | 724.702 | 172.265 | 2.28149 | 0.444604 |
| ABA 6h | 220.024 | 21.5557 | 0.695384 | 0.0610456 |
| ACC 6h | 376.725 | 49.2825 | 1.09591 | 0.0640705 |
| BABA 6h | 602.85 | 134.249 | 1.74204 | 0.354411 |
| Chitin 6h | 626.572 | 41.0976 | 1.98894 | 0.188676 |
| Epi 6h | 737.99 | 144.824 | 2.12791 | 0.648542 |
| SA 6h | 741.157 | 42.9829 | 2.53768 | 0.416679 |
| Me-JA 6h | 361.419 | 132.602 | 1.07488 | 0.32697 |
Source Transcript PGSC0003DMT400058776 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G28480.1 | +3 | 3e-31 | 114 | 66/104 (63%) | Thioredoxin superfamily protein | chr1:10013634-10014047 REVERSE LENGTH=137 |