Probe CUST_38380_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38380_PI426222305 | JHI_St_60k_v1 | DMT400022063 | GTTTCTTAGGGTACATGCATTATTCCACTGTTATCGAAAAAGGATACGCTCCACTTAAAG |
All Microarray Probes Designed to Gene DMG400008557
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38380_PI426222305 | JHI_St_60k_v1 | DMT400022063 | GTTTCTTAGGGTACATGCATTATTCCACTGTTATCGAAAAAGGATACGCTCCACTTAAAG |
Microarray Signals from CUST_38380_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1129.72 | 97.0162 | 1.06667 | 0.0616654 |
| ABA 1h | 717.529 | 68.8111 | 0.764534 | 0.0673792 |
| ACC 1h | 1068.68 | 189.958 | 0.960796 | 0.113386 |
| BABA 1h | 1048.35 | 241.695 | 0.976658 | 0.151492 |
| Chitin 1h | 1072.2 | 62.1202 | 1.13206 | 0.0723207 |
| Epi 1h | 781.311 | 47.4082 | 0.855546 | 0.0495276 |
| SA 1h | 1141.33 | 240.892 | 1.01117 | 0.152435 |
| Me-JA 1h | 404.219 | 39.8996 | 0.466547 | 0.0471373 |
| Control 6h | 1779.62 | 380.173 | 1.5965 | 0.253876 |
| ABA 6h | 416.552 | 42.1681 | 0.369147 | 0.0226652 |
| ACC 6h | 1939.69 | 332.243 | 1.56066 | 0.11793 |
| BABA 6h | 1503.05 | 345.722 | 1.21682 | 0.256581 |
| Chitin 6h | 1553.1 | 89.8622 | 1.38644 | 0.0902963 |
| Epi 6h | 1541.57 | 336.284 | 1.24059 | 0.329933 |
| SA 6h | 1145.63 | 139.743 | 1.08527 | 0.0650693 |
| Me-JA 6h | 966.605 | 290.421 | 0.832901 | 0.215225 |
Source Transcript PGSC0003DMT400022063 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G22360.1 | +1 | 0.0 | 603 | 285/476 (60%) | UDP-glucosyl transferase 85A2 | chr1:7895068-7897527 REVERSE LENGTH=481 |