Probe CUST_38169_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38169_PI426222305 | JHI_St_60k_v1 | DMT400054930 | GTCCAACTACCCACATAGAATTTAGCAGACCTTTTTACACATTGACTAACTTATTCCCTT |
All Microarray Probes Designed to Gene DMG400021315
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_38169_PI426222305 | JHI_St_60k_v1 | DMT400054930 | GTCCAACTACCCACATAGAATTTAGCAGACCTTTTTACACATTGACTAACTTATTCCCTT |
Microarray Signals from CUST_38169_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 40.5243 | 4.18127 | 0.521619 | 0.0921078 |
| ABA 1h | 100.34 | 14.132 | 1.44869 | 0.140072 |
| ACC 1h | 37.227 | 3.9774 | 0.470714 | 0.0507319 |
| BABA 1h | 65.5534 | 18.5456 | 0.805405 | 0.184757 |
| Chitin 1h | 76.0169 | 8.84774 | 1.08427 | 0.2121 |
| Epi 1h | 48.0107 | 4.14915 | 0.720087 | 0.0623354 |
| SA 1h | 57.6503 | 7.02102 | 0.718677 | 0.0988524 |
| Me-JA 1h | 58.1282 | 4.59898 | 0.924817 | 0.10835 |
| Control 6h | 108.634 | 29.8941 | 1.31653 | 0.306864 |
| ABA 6h | 272.882 | 51.7091 | 3.20755 | 0.508414 |
| ACC 6h | 116.541 | 7.77341 | 1.31876 | 0.137955 |
| BABA 6h | 132.036 | 18.9674 | 1.50092 | 0.171021 |
| Chitin 6h | 73.1691 | 13.7796 | 0.863328 | 0.152428 |
| Epi 6h | 103.983 | 15.3203 | 1.17222 | 0.128941 |
| SA 6h | 98.3863 | 16.8148 | 1.25972 | 0.376036 |
| Me-JA 6h | 76.3974 | 25.0274 | 0.875165 | 0.277858 |
Source Transcript PGSC0003DMT400054930 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G05060.1 | +3 | 3e-16 | 77 | 40/64 (63%) | NOP56-like pre RNA processing ribonucleoprotein | chr3:1413174-1415564 REVERSE LENGTH=533 |