Probe CUST_37767_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_37767_PI426222305 | JHI_St_60k_v1 | DMT400004927 | CAACTTTTTTGTTATTCTACTTTTATGATCGAGATAAAGAATCAATGCCCTCCAACCTCC |
All Microarray Probes Designed to Gene DMG400001952
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_37767_PI426222305 | JHI_St_60k_v1 | DMT400004927 | CAACTTTTTTGTTATTCTACTTTTATGATCGAGATAAAGAATCAATGCCCTCCAACCTCC |
Microarray Signals from CUST_37767_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 22.6614 | 3.60284 | 1.27721 | 0.207886 |
| ABA 1h | 37.4674 | 7.91828 | 2.30232 | 0.458971 |
| ACC 1h | 27.6417 | 11.1104 | 1.16321 | 0.752126 |
| BABA 1h | 10.6848 | 3.61412 | 0.574559 | 0.23366 |
| Chitin 1h | 7.23216 | 3.40727 | 0.430526 | 0.219119 |
| Epi 1h | 13.5263 | 3.38199 | 0.885875 | 0.22681 |
| SA 1h | 20.8054 | 3.46777 | 1.13919 | 0.194296 |
| Me-JA 1h | 5.88645 | 3.42732 | 0.409254 | 0.237087 |
| Control 6h | 11.7939 | 5.25943 | 0.559929 | 0.257123 |
| ABA 6h | 38.6632 | 4.40606 | 2.07038 | 0.237376 |
| ACC 6h | 20.3574 | 4.43682 | 1.0106 | 0.216096 |
| BABA 6h | 37.516 | 13.6678 | 1.67391 | 0.640759 |
| Chitin 6h | 17.5596 | 4.23185 | 0.902922 | 0.235199 |
| Epi 6h | 25.6686 | 4.4339 | 1.25602 | 0.224071 |
| SA 6h | 12.0126 | 5.46772 | 0.573333 | 0.265187 |
| Me-JA 6h | 15.1137 | 3.7521 | 0.843136 | 0.217558 |
Source Transcript PGSC0003DMT400004927 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G19370.1 | +2 | 3e-15 | 70 | 35/100 (35%) | Protein of unknown function (DUF1218) | chr4:10566263-10567535 REVERSE LENGTH=217 |