Probe CUST_37644_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_37644_PI426222305 | JHI_St_60k_v1 | DMT400049654 | GTGAGTGTTAACATTAGCACTGAATCCTTTCATTCTGAGGCAATGAATACTTCATTTGAA |
All Microarray Probes Designed to Gene DMG400019288
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_37644_PI426222305 | JHI_St_60k_v1 | DMT400049654 | GTGAGTGTTAACATTAGCACTGAATCCTTTCATTCTGAGGCAATGAATACTTCATTTGAA |
Microarray Signals from CUST_37644_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 3236.44 | 187.336 | 0.954599 | 0.0551224 |
| ABA 1h | 4056.09 | 790.445 | 1.29968 | 0.189835 |
| ACC 1h | 2852.58 | 914.748 | 0.709518 | 0.262218 |
| BABA 1h | 3690.07 | 310.369 | 1.12331 | 0.0648635 |
| Chitin 1h | 2567.39 | 431.166 | 0.822237 | 0.0738905 |
| Epi 1h | 2941.07 | 385.181 | 0.985499 | 0.126977 |
| SA 1h | 4155.2 | 659.042 | 1.16567 | 0.162734 |
| Me-JA 1h | 4098.75 | 449.958 | 1.46747 | 0.0885512 |
| Control 6h | 3430.74 | 604.945 | 0.976302 | 0.0975757 |
| ABA 6h | 7287.26 | 810.424 | 2.00028 | 0.125637 |
| ACC 6h | 3079.59 | 303.567 | 0.786181 | 0.0541187 |
| BABA 6h | 3715.53 | 237.934 | 0.977162 | 0.0564253 |
| Chitin 6h | 3137.51 | 322.553 | 0.862373 | 0.0823864 |
| Epi 6h | 2856.61 | 165.153 | 0.748195 | 0.068723 |
| SA 6h | 2805.11 | 483.147 | 0.811762 | 0.0672793 |
| Me-JA 6h | 5071.95 | 640.123 | 1.48301 | 0.0856277 |
Source Transcript PGSC0003DMT400049654 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G21570.1 | +1 | 1e-133 | 403 | 198/274 (72%) | Protein of unknown function (DUF300) | chr4:11471126-11472269 REVERSE LENGTH=294 |