Probe CUST_35750_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35750_PI426222305 | JHI_St_60k_v1 | DMT400046919 | CTTTGTTGGAGAAACCAATGTCCTGAACTACTTAGTTACTGAATCTTCAGACTGTTCCTA |
All Microarray Probes Designed to Gene DMG400018221
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35750_PI426222305 | JHI_St_60k_v1 | DMT400046919 | CTTTGTTGGAGAAACCAATGTCCTGAACTACTTAGTTACTGAATCTTCAGACTGTTCCTA |
Microarray Signals from CUST_35750_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 54.9887 | 7.94582 | 1.46943 | 0.120398 |
| ABA 1h | 38.0715 | 15.4826 | 0.853236 | 0.689992 |
| ACC 1h | 47.7695 | 14.6831 | 1.12251 | 0.360761 |
| BABA 1h | 36.8329 | 13.8499 | 0.912861 | 0.281764 |
| Chitin 1h | 19.5713 | 7.33122 | 0.518088 | 0.179849 |
| Epi 1h | 15.4908 | 3.13249 | 0.487262 | 0.0984545 |
| SA 1h | 41.716 | 18.8285 | 0.747086 | 0.740087 |
| Me-JA 1h | 26.2711 | 9.56143 | 0.764487 | 0.282296 |
| Control 6h | 21.8429 | 10.5116 | 0.446727 | 0.329066 |
| ABA 6h | 39.9231 | 20.6869 | 0.655792 | 0.928018 |
| ACC 6h | 50.1579 | 4.7446 | 1.18316 | 0.117206 |
| BABA 6h | 37.0352 | 10.8537 | 0.821976 | 0.238084 |
| Chitin 6h | 32.0823 | 4.43186 | 0.805693 | 0.104004 |
| Epi 6h | 47.0825 | 12.091 | 1.06001 | 0.368042 |
| SA 6h | 30.8207 | 8.94471 | 0.760504 | 0.189632 |
| Me-JA 6h | 52.8456 | 6.35269 | 1.42874 | 0.119409 |
Source Transcript PGSC0003DMT400046919 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G05390.1 | +1 | 1e-26 | 105 | 60/133 (45%) | FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: mitochondrion; EXPRESSED IN: 15 plant structures; EXPRESSED DURING: 7 growth stages; CONTAINS InterPro DOMAIN/s: Protein of unknown function DUF248, methyltransferase putative (InterPro:IPR004159); BEST Arabidopsis thaliana protein match is: S-adenosyl-L-methionine-dependent methyltransferases superfamily protein (TAIR:AT4G01240.1); Has 507 Blast hits to 498 proteins in 33 species: Archae - 4; Bacteria - 8; Metazoa - 0; Fungi - 0; Plants - 493; Viruses - 0; Other Eukaryotes - 2 (source: NCBI BLink). | chr3:1546585-1547976 REVERSE LENGTH=463 |