Probe CUST_35735_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35735_PI426222305 | JHI_St_60k_v1 | DMT400047157 | CGGATACAATCGATTATCCTACACCAATACCACCGATTAAAAAGTCGAAATAGTTGGTTG |
All Microarray Probes Designed to Gene DMG400018296
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_35735_PI426222305 | JHI_St_60k_v1 | DMT400047157 | CGGATACAATCGATTATCCTACACCAATACCACCGATTAAAAAGTCGAAATAGTTGGTTG |
Microarray Signals from CUST_35735_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 22.9485 | 3.37949 | 1.19865 | 0.182247 |
| ABA 1h | 11.3734 | 4.0744 | 0.59608 | 0.231987 |
| ACC 1h | 18.5408 | 4.96097 | 0.872853 | 0.233546 |
| BABA 1h | 25.1112 | 7.66014 | 1.24164 | 0.32579 |
| Chitin 1h | 16.3088 | 5.12192 | 0.875831 | 0.213537 |
| Epi 1h | 19.3839 | 3.25804 | 1.19185 | 0.200203 |
| SA 1h | 21.053 | 8.06959 | 0.841487 | 0.550228 |
| Me-JA 1h | 6.10355 | 3.19484 | 0.39771 | 0.207664 |
| Control 6h | 31.2357 | 11.9736 | 1.45338 | 0.504592 |
| ABA 6h | 10.3725 | 3.42227 | 0.488641 | 0.189274 |
| ACC 6h | 15.9947 | 4.05677 | 0.696036 | 0.199134 |
| BABA 6h | 42.8926 | 22.945 | 1.48022 | 1.26646 |
| Chitin 6h | 15.088 | 5.44285 | 0.662715 | 0.237162 |
| Epi 6h | 18.3872 | 4.2662 | 0.812933 | 0.19203 |
| SA 6h | 13.9896 | 4.3045 | 0.678964 | 0.220606 |
| Me-JA 6h | 24.3751 | 6.2021 | 1.22598 | 0.207445 |
Source Transcript PGSC0003DMT400047157 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |