Probe CUST_33710_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_33710_PI426222305 | JHI_St_60k_v1 | DMT400078787 | TATTCGCTAAATTTCGATGAAGGGGGACTTACGGATGAGTATCCTCGGCGTCAAATATAA |
All Microarray Probes Designed to Gene DMG400030657
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_33710_PI426222305 | JHI_St_60k_v1 | DMT400078787 | TATTCGCTAAATTTCGATGAAGGGGGACTTACGGATGAGTATCCTCGGCGTCAAATATAA |
Microarray Signals from CUST_33710_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 138.331 | 8.56005 | 1.54146 | 0.09728 |
| ABA 1h | 197.49 | 12.922 | 2.4811 | 0.287359 |
| ACC 1h | 114.834 | 12.1269 | 1.23301 | 0.19152 |
| BABA 1h | 164.169 | 29.6086 | 1.83646 | 0.183232 |
| Chitin 1h | 208.095 | 28.0254 | 2.53278 | 0.171956 |
| Epi 1h | 106.046 | 23.0864 | 1.29436 | 0.314517 |
| SA 1h | 124.459 | 19.6115 | 1.31443 | 0.155415 |
| Me-JA 1h | 49.4485 | 9.37193 | 0.653455 | 0.0652216 |
| Control 6h | 108.075 | 34.1784 | 1.05369 | 0.341567 |
| ABA 6h | 323.79 | 24.0236 | 3.3806 | 0.371549 |
| ACC 6h | 81.0586 | 5.97865 | 0.788453 | 0.116068 |
| BABA 6h | 67.5944 | 8.22612 | 0.663535 | 0.0654775 |
| Chitin 6h | 68.921 | 6.51338 | 0.715653 | 0.0552346 |
| Epi 6h | 73.9896 | 13.6704 | 0.706491 | 0.109339 |
| SA 6h | 73.1118 | 7.57814 | 0.815862 | 0.0607481 |
| Me-JA 6h | 64.8453 | 16.8837 | 0.672084 | 0.141626 |
Source Transcript PGSC0003DMT400078787 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |