Probe CUST_31012_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_31012_PI426222305 | JHI_St_60k_v1 | DMT400040285 | CAACCCAGAAAAAGAAGAGTTTTTACTGAATCACTCACAAAATTCAACAAAGGGAGGTTT |
All Microarray Probes Designed to Gene DMG400015595
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_31012_PI426222305 | JHI_St_60k_v1 | DMT400040285 | CAACCCAGAAAAAGAAGAGTTTTTACTGAATCACTCACAAAATTCAACAAAGGGAGGTTT |
Microarray Signals from CUST_31012_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 21.9596 | 3.63064 | 1.328 | 0.23098 |
| ABA 1h | 36.3648 | 3.76388 | 2.56486 | 0.265935 |
| ACC 1h | 24.7655 | 7.16106 | 1.38745 | 0.314615 |
| BABA 1h | 18.1056 | 3.65112 | 1.14543 | 0.242313 |
| Chitin 1h | 18.9184 | 3.54405 | 1.25996 | 0.247816 |
| Epi 1h | 16.3817 | 5.7182 | 0.976841 | 0.558526 |
| SA 1h | 15.436 | 8.32064 | 0.702602 | 0.415536 |
| Me-JA 1h | 8.73476 | 3.37853 | 0.648918 | 0.266332 |
| Control 6h | 16.0058 | 5.52012 | 0.863616 | 0.295665 |
| ABA 6h | 27.8275 | 8.2802 | 1.48926 | 0.455585 |
| ACC 6h | 12.8965 | 4.28233 | 0.636948 | 0.247365 |
| BABA 6h | 17.1028 | 4.08271 | 0.927433 | 0.243735 |
| Chitin 6h | 16.3938 | 6.24022 | 0.839802 | 0.327262 |
| Epi 6h | 14.5986 | 4.19548 | 0.754973 | 0.28119 |
| SA 6h | 13.0067 | 3.87864 | 0.764451 | 0.271631 |
| Me-JA 6h | 11.9827 | 3.64663 | 0.678748 | 0.255633 |
Source Transcript PGSC0003DMT400040285 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G52190.1 | +2 | 0.0 | 536 | 258/566 (46%) | Major facilitator superfamily protein | chr1:19434671-19438673 FORWARD LENGTH=607 |