Probe CUST_30868_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_30868_PI426222305 | JHI_St_60k_v1 | DMT400037951 | ATTACATCAATCGCGCAAAGCTCAAGATTAGAACTACAACAATTGTTAGTCGTAGTGATC |
All Microarray Probes Designed to Gene DMG400014639
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_30868_PI426222305 | JHI_St_60k_v1 | DMT400037951 | ATTACATCAATCGCGCAAAGCTCAAGATTAGAACTACAACAATTGTTAGTCGTAGTGATC |
Microarray Signals from CUST_30868_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 125.245 | 22.6781 | 0.741852 | 0.170311 |
| ABA 1h | 117.941 | 7.67734 | 0.81831 | 0.0848054 |
| ACC 1h | 104.506 | 52.639 | 0.481741 | 0.261214 |
| BABA 1h | 149.156 | 24.2484 | 0.923487 | 0.069342 |
| Chitin 1h | 119.544 | 31.3069 | 0.765281 | 0.17124 |
| Epi 1h | 109.301 | 30.1441 | 0.714146 | 0.222822 |
| SA 1h | 149.759 | 22.5885 | 0.874122 | 0.0982862 |
| Me-JA 1h | 142.216 | 13.525 | 1.06183 | 0.0676537 |
| Control 6h | 182.877 | 47.9775 | 1.02447 | 0.245157 |
| ABA 6h | 191.388 | 27.3116 | 1.08381 | 0.106207 |
| ACC 6h | 141.031 | 24.333 | 0.733607 | 0.0556006 |
| BABA 6h | 207.421 | 14.8535 | 1.1346 | 0.124396 |
| Chitin 6h | 152.641 | 13.2931 | 0.87596 | 0.0972939 |
| Epi 6h | 228.384 | 57.4937 | 1.16943 | 0.212393 |
| SA 6h | 310.836 | 54.2474 | 1.87859 | 0.226625 |
| Me-JA 6h | 602.145 | 89.5208 | 3.63934 | 0.503648 |
Source Transcript PGSC0003DMT400037951 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |