Probe CUST_30329_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_30329_PI426222305 | JHI_St_60k_v1 | DMT400070004 | TTCGCTATCGTCCCAAGGAGGGTGACTCATGTTTAAATATTGTCTATTGAAAATAACATG |
All Microarray Probes Designed to Gene DMG400027224
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_30329_PI426222305 | JHI_St_60k_v1 | DMT400070004 | TTCGCTATCGTCCCAAGGAGGGTGACTCATGTTTAAATATTGTCTATTGAAAATAACATG |
Microarray Signals from CUST_30329_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 337.517 | 32.493 | 1.13269 | 0.066284 |
| ABA 1h | 403.439 | 128.575 | 1.36791 | 0.485582 |
| ACC 1h | 612.434 | 139.64 | 1.89113 | 0.373012 |
| BABA 1h | 384.362 | 61.1748 | 1.3179 | 0.139124 |
| Chitin 1h | 244.561 | 32.0622 | 0.905852 | 0.121312 |
| Epi 1h | 285.238 | 38.9572 | 1.0958 | 0.15094 |
| SA 1h | 357.923 | 47.1818 | 1.15743 | 0.0957335 |
| Me-JA 1h | 124.983 | 7.95944 | 0.516241 | 0.0463461 |
| Control 6h | 167.374 | 59.2779 | 0.484774 | 0.175059 |
| ABA 6h | 689.932 | 40.0558 | 2.19268 | 0.127046 |
| ACC 6h | 498.399 | 99.315 | 1.41837 | 0.0826241 |
| BABA 6h | 358.608 | 126.018 | 0.953116 | 0.368816 |
| Chitin 6h | 251.8 | 28.8644 | 0.790319 | 0.118071 |
| Epi 6h | 246.146 | 42.6686 | 0.717517 | 0.107118 |
| SA 6h | 164.286 | 22.8091 | 0.550249 | 0.034193 |
| Me-JA 6h | 145.855 | 32.8531 | 0.473128 | 0.0989111 |
Source Transcript PGSC0003DMT400070004 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G02220.1 | +2 | 5e-17 | 73 | 36/59 (61%) | unknown protein; Has 30201 Blast hits to 17322 proteins in 780 species: Archae - 12; Bacteria - 1396; Metazoa - 17338; Fungi - 3422; Plants - 5037; Viruses - 0; Other Eukaryotes - 2996 (source: NCBI BLink). | chr5:441884-442102 REVERSE LENGTH=72 |