Probe CUST_27830_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27830_PI426222305 | JHI_St_60k_v1 | DMT400043311 | CTCACTCGGTCGATAAGCCTAAGAAATCAGATTCCGGCAAATCTAATCAACTCAAAAAAG |
All Microarray Probes Designed to Gene DMG400016812
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27830_PI426222305 | JHI_St_60k_v1 | DMT400043311 | CTCACTCGGTCGATAAGCCTAAGAAATCAGATTCCGGCAAATCTAATCAACTCAAAAAAG |
Microarray Signals from CUST_27830_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 380.692 | 32.7434 | 0.932237 | 0.0544253 |
| ABA 1h | 356.143 | 85.2126 | 0.923518 | 0.226423 |
| ACC 1h | 359.347 | 158.103 | 0.600035 | 0.515565 |
| BABA 1h | 408.991 | 128.887 | 0.909371 | 0.294165 |
| Chitin 1h | 367.957 | 129.7 | 0.880136 | 0.340006 |
| Epi 1h | 338.082 | 19.8009 | 0.962847 | 0.0563396 |
| SA 1h | 448.984 | 121.504 | 1.00944 | 0.210635 |
| Me-JA 1h | 226.344 | 39.2537 | 0.664987 | 0.0563155 |
| Control 6h | 439.116 | 160.244 | 0.952485 | 0.304919 |
| ABA 6h | 2337.25 | 611.079 | 4.958 | 1.46683 |
| ACC 6h | 1066.83 | 174.961 | 2.23479 | 0.129312 |
| BABA 6h | 663.247 | 145.326 | 1.38641 | 0.280104 |
| Chitin 6h | 492.512 | 64.679 | 1.12163 | 0.140586 |
| Epi 6h | 413.331 | 95.7154 | 0.853033 | 0.149301 |
| SA 6h | 385.703 | 63.4894 | 0.932517 | 0.059851 |
| Me-JA 6h | 515.385 | 122.381 | 1.19442 | 0.227789 |
Source Transcript PGSC0003DMT400043311 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT3G16770.1 | +1 | 2e-43 | 153 | 118/271 (44%) | ethylene-responsive element binding protein | chr3:5705784-5706768 FORWARD LENGTH=248 |