Probe CUST_27469_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27469_PI426222305 | JHI_St_60k_v1 | DMT400070904 | AAGAAAGTACATTCCGTTACTACTCTCTCCTCGGATTCTTCTACAAAAATCAAGAACGTT |
All Microarray Probes Designed to Gene DMG400027567
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27469_PI426222305 | JHI_St_60k_v1 | DMT400070904 | AAGAAAGTACATTCCGTTACTACTCTCTCCTCGGATTCTTCTACAAAAATCAAGAACGTT |
Microarray Signals from CUST_27469_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 88.4831 | 6.13454 | 1.05977 | 0.0897689 |
| ABA 1h | 68.5335 | 17.3356 | 0.876679 | 0.288663 |
| ACC 1h | 101.088 | 18.337 | 1.13986 | 0.136092 |
| BABA 1h | 92.6381 | 15.8443 | 1.11945 | 0.101611 |
| Chitin 1h | 89.3544 | 11.9363 | 1.17379 | 0.188605 |
| Epi 1h | 70.789 | 7.73004 | 0.969878 | 0.139067 |
| SA 1h | 129.578 | 22.6756 | 1.47179 | 0.240748 |
| Me-JA 1h | 61.0702 | 4.93416 | 0.895254 | 0.0725215 |
| Control 6h | 65.5551 | 8.22724 | 0.772211 | 0.0620328 |
| ABA 6h | 116.551 | 12.1763 | 1.30138 | 0.0854356 |
| ACC 6h | 146.076 | 25.3673 | 1.47623 | 0.287713 |
| BABA 6h | 292.292 | 57.3097 | 3.02564 | 0.512667 |
| Chitin 6h | 53.8823 | 8.68051 | 0.593433 | 0.0982741 |
| Epi 6h | 76.8291 | 10.9531 | 0.802839 | 0.107202 |
| SA 6h | 51.8013 | 4.94589 | 0.623111 | 0.131791 |
| Me-JA 6h | 44.5619 | 7.56293 | 0.519685 | 0.0609709 |
Source Transcript PGSC0003DMT400070904 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |