Probe CUST_27442_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27442_PI426222305 | JHI_St_60k_v1 | DMT400070844 | GATCAGTCGAAAGAATCGTCTTCTTCTTCTGGTGGTTGGTTCACTAAAATGTTCAAGAAA |
All Microarray Probes Designed to Gene DMG400027551
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_27442_PI426222305 | JHI_St_60k_v1 | DMT400070844 | GATCAGTCGAAAGAATCGTCTTCTTCTTCTGGTGGTTGGTTCACTAAAATGTTCAAGAAA |
Microarray Signals from CUST_27442_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 36.3152 | 8.12442 | 0.767654 | 0.116191 |
| ABA 1h | 53.2212 | 4.58871 | 1.32475 | 0.182551 |
| ACC 1h | 72.7154 | 9.68056 | 1.54016 | 0.14475 |
| BABA 1h | 56.3381 | 11.9607 | 1.23591 | 0.167785 |
| Chitin 1h | 41.7524 | 5.56395 | 1.00842 | 0.110638 |
| Epi 1h | 36.7577 | 7.39963 | 0.904949 | 0.190449 |
| SA 1h | 126.317 | 69.7927 | 2.01432 | 1.31279 |
| Me-JA 1h | 40.9675 | 6.69868 | 1.08167 | 0.163839 |
| Control 6h | 12.7433 | 3.98613 | 0.260642 | 0.0985663 |
| ABA 6h | 88.8056 | 18.1209 | 1.76186 | 0.315499 |
| ACC 6h | 51.2834 | 5.52284 | 0.978263 | 0.102191 |
| BABA 6h | 187.153 | 44.3954 | 3.45132 | 1.0322 |
| Chitin 6h | 10.8651 | 4.31572 | 0.215561 | 0.0953265 |
| Epi 6h | 26.9636 | 4.65531 | 0.517932 | 0.115765 |
| SA 6h | 13.282 | 4.14776 | 0.271175 | 0.129125 |
| Me-JA 6h | 13.0402 | 3.88189 | 0.262724 | 0.0975522 |
Source Transcript PGSC0003DMT400070844 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |