Probe CUST_2604_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2604_PI426222305 | JHI_St_60k_v1 | DMT400092392 | TGCTACTAGCCAATTACATCGGCGCATTGGGTAATCCCCAAAACTCCAAACCTGAAACAA |
All Microarray Probes Designed to Gene DMG400041963
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2604_PI426222305 | JHI_St_60k_v1 | DMT400092392 | TGCTACTAGCCAATTACATCGGCGCATTGGGTAATCCCCAAAACTCCAAACCTGAAACAA |
Microarray Signals from CUST_2604_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1265.37 | 281.458 | 2.3501 | 0.381092 |
| ABA 1h | 1195.81 | 245.164 | 2.53251 | 0.652025 |
| ACC 1h | 1329.64 | 274.355 | 2.40471 | 0.390134 |
| BABA 1h | 749.84 | 127.604 | 1.46894 | 0.124402 |
| Chitin 1h | 559.012 | 48.0228 | 1.20587 | 0.06994 |
| Epi 1h | 877.837 | 50.8914 | 1.97669 | 0.126055 |
| SA 1h | 678.218 | 118.756 | 1.25097 | 0.141658 |
| Me-JA 1h | 403.441 | 30.8204 | 0.959365 | 0.0558959 |
| Control 6h | 462.505 | 112.095 | 0.846765 | 0.159177 |
| ABA 6h | 265.929 | 37.4389 | 0.478827 | 0.0609919 |
| ACC 6h | 517.639 | 86.3663 | 0.85687 | 0.0556876 |
| BABA 6h | 369.222 | 39.9218 | 0.637068 | 0.0750181 |
| Chitin 6h | 495.494 | 105.612 | 0.865468 | 0.193027 |
| Epi 6h | 397.12 | 27.9008 | 0.684419 | 0.0976569 |
| SA 6h | 349.802 | 90.5794 | 0.631731 | 0.129353 |
| Me-JA 6h | 285.603 | 21.727 | 0.55684 | 0.0631868 |
Source Transcript PGSC0003DMT400092392 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G37970.1 | +1 | 9e-88 | 261 | 139/215 (65%) | SOUL heme-binding family protein | chr2:15891027-15891704 FORWARD LENGTH=225 |