Probe CUST_25015_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_25015_PI426222305 | JHI_St_60k_v1 | DMT400056352 | ATTGACAAATCTACCGATAACTTTGAGCACATTTTGAGTCAGATGCAAATCTATACTTCC |
All Microarray Probes Designed to Gene DMG400021895
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_25015_PI426222305 | JHI_St_60k_v1 | DMT400056352 | ATTGACAAATCTACCGATAACTTTGAGCACATTTTGAGTCAGATGCAAATCTATACTTCC |
Microarray Signals from CUST_25015_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 88.5553 | 35.2573 | 0.663408 | 0.221453 |
| ABA 1h | 158.122 | 56.9145 | 1.35443 | 0.519347 |
| ACC 1h | 139.503 | 56.6465 | 0.945855 | 0.476867 |
| BABA 1h | 111.233 | 39.9465 | 0.806503 | 0.38459 |
| Chitin 1h | 57.8231 | 28.205 | 0.437317 | 0.230128 |
| Epi 1h | 61.3675 | 14.331 | 0.581618 | 0.143675 |
| SA 1h | 150.056 | 50.8421 | 1.13251 | 0.366582 |
| Me-JA 1h | 95.433 | 28.4979 | 0.898176 | 0.28487 |
| Control 6h | 63.6852 | 26.0518 | 0.445491 | 0.208887 |
| ABA 6h | 1073.36 | 320.796 | 7.74823 | 2.76599 |
| ACC 6h | 699.683 | 49.6925 | 5.26699 | 0.776909 |
| BABA 6h | 893.52 | 302.898 | 6.02785 | 2.62927 |
| Chitin 6h | 111.256 | 35.4125 | 0.826891 | 0.237647 |
| Epi 6h | 131.566 | 59.4293 | 0.840789 | 0.333284 |
| SA 6h | 102.111 | 7.04954 | 0.895002 | 0.142501 |
| Me-JA 6h | 129.315 | 51.6557 | 0.975924 | 0.315266 |
Source Transcript PGSC0003DMT400056352 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT5G13080.1 | +1 | 5e-56 | 179 | 82/92 (89%) | WRKY DNA-binding protein 75 | chr5:4149928-4151019 REVERSE LENGTH=145 |