Probe CUST_24579_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_24579_PI426222305 | JHI_St_60k_v1 | DMT400054515 | CAGACATATCGTCACCCTACAGCATGTATACATTCTTGTAACTAATTTCATCAACCTTTT |
All Microarray Probes Designed to Gene DMG402021159
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_24579_PI426222305 | JHI_St_60k_v1 | DMT400054515 | CAGACATATCGTCACCCTACAGCATGTATACATTCTTGTAACTAATTTCATCAACCTTTT |
Microarray Signals from CUST_24579_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 175.913 | 38.5499 | 1.78526 | 0.269381 |
| ABA 1h | 99.6738 | 12.4037 | 1.18054 | 0.0778254 |
| ACC 1h | 125.759 | 18.9863 | 1.26885 | 0.113648 |
| BABA 1h | 141.307 | 38.9065 | 1.4079 | 0.346901 |
| Chitin 1h | 121.895 | 29.3686 | 1.35168 | 0.252094 |
| Epi 1h | 110.356 | 9.95583 | 1.34418 | 0.114007 |
| SA 1h | 135.957 | 34.0356 | 1.31717 | 0.269492 |
| Me-JA 1h | 51.2503 | 11.2921 | 0.631685 | 0.102183 |
| Control 6h | 126.639 | 37.6692 | 1.21604 | 0.317443 |
| ABA 6h | 34.8906 | 3.98674 | 0.345252 | 0.0400214 |
| ACC 6h | 78.0491 | 17.6323 | 0.682382 | 0.108657 |
| BABA 6h | 87.7446 | 23.1721 | 0.782381 | 0.199163 |
| Chitin 6h | 76.7809 | 6.35341 | 0.761822 | 0.0572585 |
| Epi 6h | 89.5897 | 17.4961 | 0.815306 | 0.145939 |
| SA 6h | 62.925 | 16.0947 | 0.62315 | 0.117961 |
| Me-JA 6h | 89.4496 | 20.8989 | 0.890777 | 0.185863 |
Source Transcript PGSC0003DMT400054515 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G18270.1 | +1 | 1e-51 | 183 | 95/188 (51%) | translocase 11 | chr4:10099364-10101897 REVERSE LENGTH=480 |