Probe CUST_23611_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_23611_PI426222305 | JHI_St_60k_v1 | DMT400015480 | CACTACCCTAATATTGGTAGACTCATCCTTAAACCATATAAATAACAACCCTTCTTCAAC |
All Microarray Probes Designed to Gene DMG400006044
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_23611_PI426222305 | JHI_St_60k_v1 | DMT400015480 | CACTACCCTAATATTGGTAGACTCATCCTTAAACCATATAAATAACAACCCTTCTTCAAC |
Microarray Signals from CUST_23611_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 4.93919 | 2.86363 | 0.750698 | 0.424382 |
| ABA 1h | 11.771 | 5.16846 | 1.63516 | 0.901501 |
| ACC 1h | 7.30435 | 3.27236 | 1.01019 | 0.494678 |
| BABA 1h | 5.22819 | 3.03728 | 0.804877 | 0.466239 |
| Chitin 1h | 7.00328 | 2.89545 | 1.15752 | 0.482836 |
| Epi 1h | 5.95636 | 2.86141 | 1.0397 | 0.490237 |
| SA 1h | 5.92831 | 2.91028 | 0.842985 | 0.42852 |
| Me-JA 1h | 5.07357 | 2.94785 | 0.947409 | 0.532312 |
| Control 6h | 11.1497 | 3.02123 | 1.49643 | 0.529168 |
| ABA 6h | 62.9108 | 17.8719 | 8.14816 | 2.81769 |
| ACC 6h | 7.83739 | 3.6442 | 0.944593 | 0.458494 |
| BABA 6h | 13.5103 | 3.42504 | 1.73741 | 0.462976 |
| Chitin 6h | 14.3556 | 4.44914 | 1.74565 | 0.7338 |
| Epi 6h | 5.89593 | 3.43963 | 0.770236 | 0.44601 |
| SA 6h | 12.2762 | 3.22469 | 1.80699 | 0.500764 |
| Me-JA 6h | 5.11256 | 2.96758 | 0.770141 | 0.441419 |
Source Transcript PGSC0003DMT400015480 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G49230.1 | +2 | 8e-58 | 187 | 101/227 (44%) | RING/U-box superfamily protein | chr1:18209320-18209979 FORWARD LENGTH=219 |