Probe CUST_23324_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_23324_PI426222305 | JHI_St_60k_v1 | DMT400073781 | CAGAACATCATCAATTGAGAATGAACCTAGAACTCTTAATCTCAACCAAATTCAGTTTGC |
All Microarray Probes Designed to Gene DMG400028663
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_23324_PI426222305 | JHI_St_60k_v1 | DMT400073781 | CAGAACATCATCAATTGAGAATGAACCTAGAACTCTTAATCTCAACCAAATTCAGTTTGC |
Microarray Signals from CUST_23324_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 34.6245 | 5.90358 | 2.71839 | 0.421979 |
| ABA 1h | 171.948 | 20.3974 | 15.4829 | 0.953144 |
| ACC 1h | 29.0748 | 5.6022 | 2.19717 | 0.429439 |
| BABA 1h | 22.7395 | 8.73897 | 1.52049 | 0.740576 |
| Chitin 1h | 22.0491 | 3.88246 | 1.93179 | 0.347392 |
| Epi 1h | 26.477 | 3.78004 | 2.45636 | 0.349134 |
| SA 1h | 28.4515 | 6.04666 | 2.14546 | 0.320521 |
| Me-JA 1h | 25.3477 | 7.36025 | 2.24786 | 0.85497 |
| Control 6h | 6.78559 | 3.93752 | 0.546499 | 0.316636 |
| ABA 6h | 12.413 | 4.12101 | 0.870508 | 0.348436 |
| ACC 6h | 7.58595 | 4.48714 | 0.524651 | 0.304158 |
| BABA 6h | 8.13471 | 4.33084 | 0.584292 | 0.312908 |
| Chitin 6h | 7.51807 | 4.3627 | 0.570147 | 0.330392 |
| Epi 6h | 8.57262 | 4.81162 | 0.60524 | 0.330251 |
| SA 6h | 7.21428 | 4.19028 | 0.589296 | 0.342126 |
| Me-JA 6h | 6.86806 | 3.885 | 0.556926 | 0.315472 |
Source Transcript PGSC0003DMT400073781 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT4G33467.1 | +1 | 5e-14 | 67 | 43/98 (44%) | unknown protein; Has 25 Blast hits to 25 proteins in 9 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 25; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr4:16101691-16102084 REVERSE LENGTH=102 |