Probe CUST_2270_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2270_PI426222305 | JHI_St_60k_v1 | DMT400072393 | TATCTTTGGAATTTGGATATTCCCTCTCCATTGAGGTTTTCACCATGCATTATTGGTTAA |
All Microarray Probes Designed to Gene DMG400028167
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2270_PI426222305 | JHI_St_60k_v1 | DMT400072393 | TATCTTTGGAATTTGGATATTCCCTCTCCATTGAGGTTTTCACCATGCATTATTGGTTAA |
Microarray Signals from CUST_2270_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 1299.85 | 119.158 | 1.91351 | 0.110591 |
| ABA 1h | 2440.36 | 269.126 | 4.04208 | 0.233437 |
| ACC 1h | 868.249 | 111.39 | 1.23227 | 0.0721812 |
| BABA 1h | 799.757 | 191.416 | 1.14439 | 0.211651 |
| Chitin 1h | 611.035 | 48.5077 | 1.00205 | 0.0601859 |
| Epi 1h | 783.66 | 89.204 | 1.32631 | 0.123602 |
| SA 1h | 807.213 | 108.662 | 1.14648 | 0.0833745 |
| Me-JA 1h | 420.627 | 39.0201 | 0.757876 | 0.0442188 |
| Control 6h | 569.662 | 66.1774 | 0.831331 | 0.0482887 |
| ABA 6h | 1621.35 | 141.344 | 2.2466 | 0.129804 |
| ACC 6h | 656.581 | 71.5206 | 0.83973 | 0.0487682 |
| BABA 6h | 673.027 | 63.1303 | 0.884325 | 0.108952 |
| Chitin 6h | 680.107 | 58.7591 | 0.941614 | 0.0582508 |
| Epi 6h | 662.685 | 38.4966 | 0.872093 | 0.0765082 |
| SA 6h | 627.626 | 115.208 | 0.904832 | 0.0801153 |
| Me-JA 6h | 455.631 | 97.3592 | 0.645545 | 0.0956918 |
Source Transcript PGSC0003DMT400072393 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc10g083460.1 | +1 | 1e-79 | 243 | 138/160 (86%) | evidence_code:10F1H1E1IEG genomic_reference:SL2.50ch10 gene_region:62577522-62578001 transcript_region:SL2.50ch10:62577522..62578001+ go_terms:GO:0008270 functional_description:Zinc finger A20 and AN1 domain-containing stress-associated protein 6 (AHRD V1 *-*- C1BNQ4_9MAXI); contains Interpro domain(s) IPR000058 Zinc finger, AN1-type |
| TAIR PP10 | AT2G36320.1 | +1 | 6e-47 | 158 | 85/161 (53%) | A20/AN1-like zinc finger family protein | chr2:15229388-15229873 FORWARD LENGTH=161 |