Probe CUST_22541_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_22541_PI426222305 | JHI_St_60k_v1 | DMT400078006 | TCGGCTCTGTTTCTAGCCTAATGGCGTAATTGTACTTTCTTTGAAATTCCATGTTGAATA |
All Microarray Probes Designed to Gene DMG400030339
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_22541_PI426222305 | JHI_St_60k_v1 | DMT400078006 | TCGGCTCTGTTTCTAGCCTAATGGCGTAATTGTACTTTCTTTGAAATTCCATGTTGAATA |
Microarray Signals from CUST_22541_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 7944.22 | 2460.92 | 32.9481 | 10.3798 |
| ABA 1h | 12611.8 | 11114.7 | 19.1027 | 98.1831 |
| ACC 1h | 6881.49 | 5269.26 | 12.7141 | 28.7868 |
| BABA 1h | 1204.55 | 941.045 | 2.65731 | 3.78014 |
| Chitin 1h | 482.117 | 331.003 | 1.46723 | 1.31425 |
| Epi 1h | 4521.98 | 1943.43 | 18.0736 | 14.2311 |
| SA 1h | 1162.62 | 613.29 | 3.28598 | 3.58727 |
| Me-JA 1h | 494.321 | 51.1095 | 2.70737 | 0.494578 |
| Control 6h | 90.5591 | 27.3372 | 0.376361 | 0.102723 |
| ABA 6h | 268.336 | 16.0433 | 1.13976 | 0.100112 |
| ACC 6h | 61.068 | 19.7426 | 0.214366 | 0.124418 |
| BABA 6h | 71.6103 | 41.6403 | 0.204548 | 0.175305 |
| Chitin 6h | 45.0822 | 10.2343 | 0.179709 | 0.0558453 |
| Epi 6h | 29.6563 | 9.59001 | 0.105181 | 0.0323057 |
| SA 6h | 31.6729 | 14.1312 | 0.11258 | 0.0554401 |
| Me-JA 6h | 103.777 | 75.4183 | 0.204772 | 0.537441 |
Source Transcript PGSC0003DMT400078006 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT1G07400.1 | +1 | 1e-68 | 212 | 121/157 (77%) | HSP20-like chaperones superfamily protein | chr1:2275148-2275621 FORWARD LENGTH=157 |