Probe CUST_21846_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_21846_PI426222305 | JHI_St_60k_v1 | DMT400043597 | CACCAGCAAAACAGATCTACCATAGCTCTGATACAATGTAATAGATAATGTCTGGATAAT |
All Microarray Probes Designed to Gene DMG401016929
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_21846_PI426222305 | JHI_St_60k_v1 | DMT400043597 | CACCAGCAAAACAGATCTACCATAGCTCTGATACAATGTAATAGATAATGTCTGGATAAT |
Microarray Signals from CUST_21846_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 28.1306 | 3.77273 | 2.83953 | 0.391405 |
| ABA 1h | 5.74196 | 3.33765 | 0.661498 | 0.383659 |
| ACC 1h | 11.9662 | 3.83162 | 1.10942 | 0.425705 |
| BABA 1h | 11.0964 | 3.7 | 1.15358 | 0.403241 |
| Chitin 1h | 8.68783 | 3.52433 | 0.92389 | 0.439192 |
| Epi 1h | 12.2414 | 3.51845 | 1.43814 | 0.416805 |
| SA 1h | 12.6336 | 4.96709 | 1.09198 | 0.403702 |
| Me-JA 1h | 8.5385 | 3.55489 | 1.02944 | 0.469676 |
| Control 6h | 14.7859 | 3.72215 | 1.41462 | 0.426904 |
| ABA 6h | 12.3561 | 3.79839 | 1.11371 | 0.412046 |
| ACC 6h | 8.28057 | 4.45182 | 0.693284 | 0.375426 |
| BABA 6h | 15.608 | 7.41042 | 1.14209 | 0.592739 |
| Chitin 6h | 11.4213 | 3.97399 | 1.04037 | 0.404826 |
| Epi 6h | 17.1807 | 4.28742 | 1.54113 | 0.383554 |
| SA 6h | 8.00897 | 3.77744 | 0.802838 | 0.40357 |
| Me-JA 6h | 7.35964 | 3.604 | 0.73427 | 0.377353 |
Source Transcript PGSC0003DMT400043597 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |