Probe CUST_21482_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_21482_PI426222305 | JHI_St_60k_v1 | DMT400086222 | ATGTATCAAACGCTATGTATTCCGTGCACAACGCTATGTATCCCGTGCACAACGCTATGT |
All Microarray Probes Designed to Gene DMG400035793
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_21482_PI426222305 | JHI_St_60k_v1 | DMT400086222 | ATGTATCAAACGCTATGTATTCCGTGCACAACGCTATGTATCCCGTGCACAACGCTATGT |
Microarray Signals from CUST_21482_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 6034.32 | 1078.91 | 2.32256 | 0.253003 |
| ABA 1h | 5085.93 | 1219.64 | 2.12717 | 0.471331 |
| ACC 1h | 4278.13 | 1622.72 | 1.27733 | 0.778953 |
| BABA 1h | 4234.24 | 1109.43 | 1.60459 | 0.330643 |
| Chitin 1h | 2219.87 | 465.594 | 0.941226 | 0.126119 |
| Epi 1h | 2901.47 | 343.685 | 1.31002 | 0.149223 |
| SA 1h | 5069.32 | 611.221 | 1.93075 | 0.111813 |
| Me-JA 1h | 1548.86 | 264.722 | 0.732952 | 0.0690907 |
| Control 6h | 2118.9 | 298.004 | 0.822078 | 0.0691525 |
| ABA 6h | 2830.01 | 238.845 | 1.04877 | 0.0605615 |
| ACC 6h | 2418.95 | 172.116 | 0.832593 | 0.0659977 |
| BABA 6h | 2667.45 | 270.847 | 0.935257 | 0.0678209 |
| Chitin 6h | 2284.9 | 132.198 | 0.850399 | 0.0491129 |
| Epi 6h | 2611.16 | 464.333 | 0.88901 | 0.0967821 |
| SA 6h | 2404.93 | 285.888 | 0.950885 | 0.175472 |
| Me-JA 6h | 1523.71 | 369.527 | 0.571604 | 0.0951061 |
Source Transcript PGSC0003DMT400086222 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | None | - | - | - | - | - |