Probe CUST_2065_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2065_PI426222305 | JHI_St_60k_v1 | DMT400028768 | TTGCAAGTGTGAGAATCGACAATGGAGCGAATCGTGATTTGTTGTTCTTGAAACAAAAAA |
All Microarray Probes Designed to Gene DMG400011073
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_2065_PI426222305 | JHI_St_60k_v1 | DMT400028768 | TTGCAAGTGTGAGAATCGACAATGGAGCGAATCGTGATTTGTTGTTCTTGAAACAAAAAA |
Microarray Signals from CUST_2065_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 991.592 | 116.161 | 1.82639 | 0.201679 |
| ABA 1h | 1040.02 | 89.8892 | 2.17953 | 0.126033 |
| ACC 1h | 541.847 | 117.952 | 0.929027 | 0.167745 |
| BABA 1h | 1050.78 | 229.241 | 1.93629 | 0.271951 |
| Chitin 1h | 872.531 | 62.6398 | 1.80318 | 0.104352 |
| Epi 1h | 654.471 | 37.9683 | 1.41147 | 0.0818254 |
| SA 1h | 634.403 | 114.875 | 1.1097 | 0.170731 |
| Me-JA 1h | 411.073 | 80.5422 | 0.900191 | 0.197497 |
| Control 6h | 221.369 | 64.7693 | 0.370752 | 0.0968972 |
| ABA 6h | 1097.44 | 299.929 | 1.76093 | 0.488736 |
| ACC 6h | 382.078 | 43.5142 | 0.614453 | 0.0381723 |
| BABA 6h | 443.519 | 83.407 | 0.715907 | 0.105119 |
| Chitin 6h | 267.978 | 36.2695 | 0.46119 | 0.0625058 |
| Epi 6h | 284.657 | 31.6507 | 0.466157 | 0.0599245 |
| SA 6h | 124.693 | 20.221 | 0.229256 | 0.0183304 |
| Me-JA 6h | 302.856 | 88.9769 | 0.521732 | 0.112144 |
Source Transcript PGSC0003DMT400028768 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | Solyc10g084880.2 | +2 | 0.0 | 858 | 443/472 (94%) | genomic_reference:SL2.50ch10 gene_region:63580319-63582004 transcript_region:SL2.50ch10:63580319..63582004- functional_description:Avr9/Cf-9 rapidly elicited protein 137 (AHRD V1 ***- Q9FQZ2_TOBAC); contains Interpro domain(s) IPR007700 Protein of unknown function DUF668 |
| TAIR PP10 | AT3G23160.1 | +2 | 2e-81 | 267 | 180/482 (37%) | Protein of unknown function (DUF668) | chr3:8260059-8261654 REVERSE LENGTH=531 |