Probe CUST_20450_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_20450_PI426222305 | JHI_St_60k_v1 | DMT400068342 | CAACAAAAAGCATTGCTCAATCAACAGTTGGAGCAACTTGGTTCAATTACTAATTCCCCT |
All Microarray Probes Designed to Gene DMG400026576
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_20450_PI426222305 | JHI_St_60k_v1 | DMT400068342 | CAACAAAAAGCATTGCTCAATCAACAGTTGGAGCAACTTGGTTCAATTACTAATTCCCCT |
Microarray Signals from CUST_20450_PI426222305
| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 29.2069 | 9.57454 | 1.19131 | 0.339533 |
| ABA 1h | 19.2536 | 6.54349 | 0.820025 | 0.553277 |
| ACC 1h | 58.3595 | 15.0483 | 2.36955 | 0.528611 |
| BABA 1h | 18.3765 | 3.93174 | 0.821328 | 0.198859 |
| Chitin 1h | 20.9948 | 4.0341 | 1.01363 | 0.271519 |
| Epi 1h | 20.1905 | 4.1649 | 1.00551 | 0.210275 |
| SA 1h | 177.89 | 23.2336 | 7.68704 | 0.520991 |
| Me-JA 1h | 11.3122 | 3.67996 | 0.571255 | 0.217979 |
| Control 6h | 39.3022 | 8.75544 | 1.66377 | 0.287822 |
| ABA 6h | 13.5543 | 4.86084 | 0.50634 | 0.237854 |
| ACC 6h | 7.8931 | 4.60902 | 0.303629 | 0.171626 |
| BABA 6h | 25.6529 | 4.99532 | 0.998356 | 0.195972 |
| Chitin 6h | 20.0952 | 4.21945 | 0.849932 | 0.179331 |
| Epi 6h | 19.1155 | 5.26034 | 0.69014 | 0.319402 |
| SA 6h | 26.5475 | 7.29998 | 1.12897 | 0.477643 |
| Me-JA 6h | 21.5892 | 7.44006 | 0.849593 | 0.36105 |
Source Transcript PGSC0003DMT400068342 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G40435.1 | +1 | 3e-30 | 110 | 64/124 (52%) | BEST Arabidopsis thaliana protein match is: transcription regulators (TAIR:AT3G56220.1); Has 289 Blast hits to 289 proteins in 30 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 289; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:16887048-16888407 FORWARD LENGTH=158 |