Probe CUST_20019_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_20019_PI426222305 | JHI_St_60k_v1 | DMT400049277 | GCCCACAGCTTTACTTGCATATTGTTATTATTATGGTGATGTAATGGCAAATTATTGCCT |
All Microarray Probes Designed to Gene DMG400019153
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_20019_PI426222305 | JHI_St_60k_v1 | DMT400049277 | GCCCACAGCTTTACTTGCATATTGTTATTATTATGGTGATGTAATGGCAAATTATTGCCT |
Microarray Signals from CUST_20019_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 95.4665 | 20.7259 | 1.20276 | 0.175085 |
| ABA 1h | 34.4639 | 13.024 | 0.407498 | 0.268704 |
| ACC 1h | 121.832 | 32.0971 | 1.45136 | 0.304338 |
| BABA 1h | 83.4537 | 13.0932 | 1.10931 | 0.0847147 |
| Chitin 1h | 71.4655 | 15.3681 | 0.998096 | 0.286059 |
| Epi 1h | 85.0639 | 8.0779 | 1.2837 | 0.0895337 |
| SA 1h | 107.992 | 7.23424 | 1.38247 | 0.0925525 |
| Me-JA 1h | 83.6382 | 14.3554 | 1.30867 | 0.119999 |
| Control 6h | 83.7475 | 27.1839 | 0.963208 | 0.299947 |
| ABA 6h | 9.37267 | 4.08935 | 0.110604 | 0.0538471 |
| ACC 6h | 49.3767 | 5.19332 | 0.561281 | 0.0584519 |
| BABA 6h | 78.1867 | 6.29688 | 0.919447 | 0.0744036 |
| Chitin 6h | 70.1031 | 15.4485 | 0.829963 | 0.177211 |
| Epi 6h | 67.8397 | 10.9721 | 0.771898 | 0.164362 |
| SA 6h | 59.4967 | 5.40842 | 0.786848 | 0.137699 |
| Me-JA 6h | 39.9282 | 4.5547 | 0.525665 | 0.0601726 |
Source Transcript PGSC0003DMT400049277 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G37640.1 | +1 | 2e-148 | 426 | 200/255 (78%) | Barwin-like endoglucanases superfamily protein | chr2:15788077-15789812 REVERSE LENGTH=262 |