Probe CUST_19285_PI426222305 - General Information
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_19285_PI426222305 | JHI_St_60k_v1 | DMT400072807 | CATATAGCTATCGTTACAAAAGTGGCTCAATATATCTCTACTGTTACAAAACAGACTCAC |
All Microarray Probes Designed to Gene DMG400028327
| Probe ID | Chip name | Transcript ID | Probe Sequence |
|---|---|---|---|
| CUST_19285_PI426222305 | JHI_St_60k_v1 | DMT400072807 | CATATAGCTATCGTTACAAAAGTGGCTCAATATATCTCTACTGTTACAAAACAGACTCAC |
Microarray Signals from CUST_19285_PI426222305

| Treatment | Raw signal | Raw Std Err | Normalized signal | Normalized Std Err |
|---|---|---|---|---|
| Control 1h | 408.539 | 59.5164 | 1.11601 | 0.0861249 |
| ABA 1h | 291.802 | 18.7557 | 0.915917 | 0.0888759 |
| ACC 1h | 369.488 | 67.3459 | 0.964447 | 0.124624 |
| BABA 1h | 291.577 | 51.4849 | 0.813417 | 0.0761236 |
| Chitin 1h | 248.892 | 18.5334 | 0.767724 | 0.0946704 |
| Epi 1h | 266.082 | 50.8453 | 0.823095 | 0.156982 |
| SA 1h | 367.361 | 21.5436 | 0.996392 | 0.0616533 |
| Me-JA 1h | 215.907 | 17.8445 | 0.732494 | 0.0595195 |
| Control 6h | 555.71 | 120.745 | 1.46373 | 0.236837 |
| ABA 6h | 193.01 | 11.8084 | 0.505091 | 0.0308323 |
| ACC 6h | 407.947 | 96.0751 | 0.925871 | 0.1867 |
| BABA 6h | 538.869 | 83.2467 | 1.31232 | 0.209019 |
| Chitin 6h | 582.051 | 95.7907 | 1.48679 | 0.198016 |
| Epi 6h | 486.451 | 28.4936 | 1.20127 | 0.108163 |
| SA 6h | 455.445 | 75.2994 | 1.24441 | 0.0839613 |
| Me-JA 6h | 257.993 | 74.4387 | 0.666947 | 0.136606 |
Source Transcript PGSC0003DMT400072807 - Homology to Model Species (BLASTX to E-value < 1e-50)
| Database | Link to BLAST Hit | Frame | E-value | Score | % Identity | Description |
|---|---|---|---|---|---|---|
| Tomato (ITAG) | None | - | - | - | - | - |
| TAIR PP10 | AT2G03420.1 | +2 | 2e-43 | 150 | 96/161 (60%) | unknown protein; Has 38 Blast hits to 38 proteins in 17 species: Archae - 0; Bacteria - 0; Metazoa - 0; Fungi - 0; Plants - 38; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink). | chr2:1035100-1035937 REVERSE LENGTH=170 |